Construct: ORF TRCN0000479403
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012601.2_s317c1
- Derived from:
- ccsbBroadEn_09862
- DNA Barcode:
- GACCACTCCAATCGCGGAGAGCCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MARCHF8 (220972)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479403
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 220972 | MARCHF8 | membrane associated ring-CH... | NM_001002266.3 | 99.8% | 99.6% | 796T>C |
2 | human | 220972 | MARCHF8 | membrane associated ring-CH... | NM_145021.5 | 99.8% | 99.6% | 796T>C |
3 | human | 220972 | MARCHF8 | membrane associated ring-CH... | XM_011539495.1 | 99.8% | 99.6% | 796T>C |
4 | human | 220972 | MARCHF8 | membrane associated ring-CH... | NM_001282866.2 | 50.7% | 50.6% | 236_1081del;1642T>C |
5 | human | 220972 | MARCHF8 | membrane associated ring-CH... | XM_005271804.3 | 50.7% | 50.6% | 236_1081del;1642T>C |
6 | human | 220972 | MARCHF8 | membrane associated ring-CH... | XM_006717704.2 | 50.7% | 50.6% | 236_1081del;1642T>C |
7 | human | 220972 | MARCHF8 | membrane associated ring-CH... | XM_011539492.3 | 50.7% | 50.6% | 236_1081del;1642T>C |
8 | human | 220972 | MARCHF8 | membrane associated ring-CH... | XR_246519.3 | 13.9% | (many diffs) | |
9 | mouse | 71779 | March8 | membrane-associated ring fi... | NM_001302383.1 | 87.8% | 91.4% | (many diffs) |
10 | mouse | 71779 | March8 | membrane-associated ring fi... | NM_001302384.1 | 87.8% | 91.4% | (many diffs) |
11 | mouse | 71779 | March8 | membrane-associated ring fi... | NM_027920.5 | 87.8% | 91.4% | (many diffs) |
12 | mouse | 71779 | March8 | membrane-associated ring fi... | XM_006506648.3 | 79.7% | 82.5% | (many diffs) |
13 | mouse | 71779 | March8 | membrane-associated ring fi... | NM_001302385.1 | 75.5% | 78.7% | (many diffs) |
14 | mouse | 71779 | March8 | membrane-associated ring fi... | XM_011241470.2 | 75.5% | 78.7% | (many diffs) |
15 | mouse | 71779 | March8 | membrane-associated ring fi... | XM_017321749.1 | 75.5% | 78.7% | (many diffs) |
16 | mouse | 71779 | March8 | membrane-associated ring fi... | XM_006506643.3 | 45% | 41.9% | (many diffs) |
17 | mouse | 71779 | March8 | membrane-associated ring fi... | XM_006506638.3 | 44.7% | 46.5% | (many diffs) |
18 | mouse | 71779 | March8 | membrane-associated ring fi... | XM_006506639.3 | 44.7% | 46.5% | (many diffs) |
19 | mouse | 71779 | March8 | membrane-associated ring fi... | XM_006506640.3 | 44.7% | 46.5% | (many diffs) |
20 | mouse | 71779 | March8 | membrane-associated ring fi... | XM_006506641.3 | 44.7% | 46.5% | (many diffs) |
21 | mouse | 71779 | March8 | membrane-associated ring fi... | XM_006506642.1 | 44.7% | 46.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 939
- ORF length:
- 873
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag catgccactg catcagatct ctgccattcc atcccaggat gccatctctg 121 ctagagtcta cagaagtaag accaaagaaa aggagaggga agaacagaat gagaagactt 181 tgggacattt catgagtcat tcaagcaaca tttctaaggc tgggagtcct ccgtcagcat 241 cagctccggc tccggtgtcc tccttctctc gcacttctat cacgccatcc agccaggaca 301 tctgcaggat ctgccactgt gaaggagatg atgagagccc cctgatcacc ccctgccact 361 gcacaggaag cctccacttc gtgcaccagg cctgcctgca gcagtggatc aagagctccg 421 acacgcgctg ctgcgagctc tgcaagtatg agttcatcat ggagaccaag ctgaagccac 481 tgagaaaatg ggagaagttg cagatgacgt ccagcgagcg caggaagatc atgtgctcag 541 tgacattcca cgtcattgcc atcacatgtg tggtctggtc cttGTATGTG CTCATTGACC 601 GTACTGCTGA GGAGATCAAG CAGGGGCAGG CAACAGGAAT CCTAGAATGG CCCTTTTGGA 661 CTAAATTGGT GGTTGTGGCC ATCGGCTTCA CCGGAGGACT TCTTTTTATG TATGTTCAGT 721 GTAAAGTGTA TGTGCAATTG TGGAAGAGAC TCAAGGCCTA TAATAGAGTG ATCTATGTTC 781 AAAACTGTCC AGAAACAAGC AAAAAGAATA TTTTTGAAAA ATCTCCACTA ACAGAGCCCA 841 ACTTTGAAAA TAAACATGGA CATGGAATCT GTCATTCCGA CACAAACTCT TCTTGTTGCA 901 CAGAGCCTGA AGACACTGGA GCAGAAATCA TTCACGTCTG CCCAACTTTC TTGTACAAAG 961 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1021 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1081 ACGAGACCAC TCCAATCGCG GAGAGCCTAC GCGTTAAGTC gacaatcaac ctctggatta 1141 caaaatttgt gaaagatt