Transcript: Human XM_011539590.2

PREDICTED: Homo sapiens attractin like 1 (ATRNL1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATRNL1 (26033)
Length:
10629
CDS:
2722..6423

Additional Resources:

NCBI RefSeq record:
XM_011539590.2
NBCI Gene record:
ATRNL1 (26033)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011539590.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000444505 GATGGCCCAATTAACTATAAA pLKO_005 2605 5UTR 100% 15.000 12.000 N ATRNL1 n/a
2 TRCN0000063155 GCCCTAATAGATATTTCACAA pLKO.1 6319 CDS 100% 4.950 3.960 N ATRNL1 n/a
3 TRCN0000444538 GATTGTATGCCAGGTTATTAT pLKO_005 5407 CDS 100% 15.000 10.500 N ATRNL1 n/a
4 TRCN0000445662 TATGTTCATGGAGGGTATAAA pLKO_005 3727 CDS 100% 15.000 10.500 N ATRNL1 n/a
5 TRCN0000063154 GCACCTTTAATAGCTGTACTT pLKO.1 2752 CDS 100% 4.950 3.465 N ATRNL1 n/a
6 TRCN0000063153 GCCAATTATGTGACTCTGAAA pLKO.1 5546 CDS 100% 4.950 3.465 N ATRNL1 n/a
7 TRCN0000063156 GCCAGGGAACAAATATGGATT pLKO.1 3753 CDS 100% 4.950 3.465 N ATRNL1 n/a
8 TRCN0000063157 GCCAATACAAATGGGTGCCAA pLKO.1 4315 CDS 100% 2.640 1.848 N ATRNL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011539590.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15032 pDONR223 96.6% 22.8% 22% None (many diffs) n/a
2 ccsbBroad304_15032 pLX_304 0% 22.8% 22% V5 (many diffs) n/a
3 TRCN0000466299 GCGAATTAGCAAAAGAGCGTCGAG pLX_317 29.2% 22.8% 22% V5 (many diffs) n/a
Download CSV