Transcript: Human XM_011539634.2

PREDICTED: Homo sapiens GDNF family receptor alpha 1 (GFRA1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GFRA1 (2674)
Length:
9409
CDS:
539..1936

Additional Resources:

NCBI RefSeq record:
XM_011539634.2
NBCI Gene record:
GFRA1 (2674)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011539634.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060629 CCAACTACATAGACTCCAGTA pLKO.1 1434 CDS 100% 4.050 5.670 N GFRA1 n/a
2 TRCN0000060632 CGACGACATTTGCAAGAAGTA pLKO.1 1027 CDS 100% 4.950 3.960 N GFRA1 n/a
3 TRCN0000060631 GCAGGGTCTGAGAATGAAATT pLKO.1 1679 CDS 100% 13.200 9.240 N GFRA1 n/a
4 TRCN0000060628 CCTCTGTATTTCCAATGGTAA pLKO.1 1774 CDS 100% 4.950 3.465 N GFRA1 n/a
5 TRCN0000060630 GCGCATTTACTGGAGCATGTA pLKO.1 838 CDS 100% 4.950 3.465 N GFRA1 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 8324 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011539634.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000468740 CACCCGGGCCTTACATTGGCTGAT pLX_317 16.2% 98.8% 98.9% V5 417_431del;552C>T n/a
2 ccsbBroadEn_06270 pDONR223 100% 98.7% 98.7% None 417_431del;552C>T;1379C>N n/a
3 ccsbBroad304_06270 pLX_304 0% 98.7% 98.7% V5 417_431del;552C>T;1379C>N n/a
Download CSV