Transcript: Human XM_011539747.2

PREDICTED: Homo sapiens dual specificity phosphatase and pro isomerase domain containing 1 (DUPD1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DUPD1 (338599)
Length:
4872
CDS:
421..1083

Additional Resources:

NCBI RefSeq record:
XM_011539747.2
NBCI Gene record:
DUPD1 (338599)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011539747.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359798 CTAAGCGACGACCACAGTAAG pLKO_005 826 CDS 100% 10.800 15.120 N DUPD1 n/a
2 TRCN0000049125 GCCCGACTACTACCGCGACAT pLKO.1 711 CDS 100% 0.000 0.000 N DUPD1 n/a
3 TRCN0000363243 TCTGGCCCAAGCTCTACATTG pLKO_005 593 CDS 100% 10.800 7.560 N DUPD1 n/a
4 TRCN0000359730 GCCTCAAGAATGCCTACTCAT pLKO_005 446 CDS 100% 4.950 3.465 N DUPD1 n/a
5 TRCN0000049126 CAAGCTCTACATTGGCGATGA pLKO.1 600 CDS 100% 4.050 2.835 N DUPD1 n/a
6 TRCN0000049123 CCTGATGATCCACAAGGACAT pLKO.1 903 CDS 100% 4.050 2.835 N DUPD1 n/a
7 TRCN0000363283 GGCCTACCTGATGATCCACAA pLKO_005 897 CDS 100% 4.050 2.835 N DUPD1 n/a
8 TRCN0000049124 GACCACAGTAAGATCCTGGTT pLKO.1 835 CDS 100% 2.640 1.848 N DUPD1 n/a
9 TRCN0000049127 CCGCGACATGGACATCCAGTA pLKO.1 723 CDS 100% 1.350 0.945 N DUPD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011539747.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05440 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05440 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000481583 AAACACTGTCCTCACTCACAGCGC pLX_317 73% 100% 100% V5 n/a
Download CSV