Transcript: Human XM_011539927.3

PREDICTED: Homo sapiens renalase, FAD dependent amine oxidase (RNLS), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNLS (55328)
Length:
6073
CDS:
1291..2208

Additional Resources:

NCBI RefSeq record:
XM_011539927.3
NBCI Gene record:
RNLS (55328)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011539927.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151102 GCTTCGTCTCCATTGATAATA pLKO.1 1955 CDS 100% 15.000 21.000 N RNLS n/a
2 TRCN0000371441 GTGAGCTACTCCTCTCGATAT pLKO_005 1852 CDS 100% 10.800 15.120 N RNLS n/a
3 TRCN0000156235 CCTCTAAGCTCGCCTATTGAA pLKO.1 1552 CDS 100% 5.625 7.875 N RNLS n/a
4 TRCN0000151231 GATCAACCTAAGAGATGACAA pLKO.1 1692 CDS 100% 4.950 6.930 N RNLS n/a
5 TRCN0000339178 TGATAATAAGAAGCGCAATAT pLKO_005 1968 CDS 100% 13.200 10.560 N Rnls n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011539927.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08519 pDONR223 100% 86.1% 84.1% None (many diffs) n/a
2 ccsbBroad304_08519 pLX_304 0% 86.1% 84.1% V5 (many diffs) n/a
3 TRCN0000471759 AAACGTTTCAACTTCTCTCCTGCA pLX_317 42.7% 86.1% 84.1% V5 (many diffs) n/a
Download CSV