Transcript: Human XM_011540030.1

PREDICTED: Homo sapiens heparanase 2 (inactive) (HPSE2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HPSE2 (60495)
Length:
4174
CDS:
61..1677

Additional Resources:

NCBI RefSeq record:
XM_011540030.1
NBCI Gene record:
HPSE2 (60495)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011540030.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431976 GTCGTGATACGGCACTCATTT pLKO_005 1147 CDS 100% 13.200 18.480 N HPSE2 n/a
2 TRCN0000159951 GCACAAACAATCTATCCGATT pLKO.1 1064 CDS 100% 4.050 5.670 N HPSE2 n/a
3 TRCN0000425509 GCTTATATGGCCCTAATATTG pLKO_005 797 CDS 100% 13.200 9.240 N HPSE2 n/a
4 TRCN0000158426 CCAAAGAGACTAAATGTCATA pLKO.1 1818 3UTR 100% 4.950 3.465 N HPSE2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011540030.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08799 pDONR223 100% 90.7% 90.5% None 447_448ins162;1378G>A;1574A>T n/a
2 ccsbBroad304_08799 pLX_304 0% 90.7% 90.5% V5 447_448ins162;1378G>A;1574A>T n/a
3 TRCN0000475450 ACTGCCGATATAGAACTCCATGTA pLX_317 23.1% 90.7% 90.5% V5 447_448ins162;1378G>A;1574A>T n/a
Download CSV