Transcript: Human XM_011540031.2

PREDICTED: Homo sapiens heparanase 2 (inactive) (HPSE2), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HPSE2 (60495)
Length:
3958
CDS:
199..1461

Additional Resources:

NCBI RefSeq record:
XM_011540031.2
NBCI Gene record:
HPSE2 (60495)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011540031.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431976 GTCGTGATACGGCACTCATTT pLKO_005 931 CDS 100% 13.200 18.480 N HPSE2 n/a
2 TRCN0000159951 GCACAAACAATCTATCCGATT pLKO.1 848 CDS 100% 4.050 5.670 N HPSE2 n/a
3 TRCN0000159622 GAAGTGATGTTGCCTTAGATA pLKO.1 140 5UTR 100% 5.625 4.500 N HPSE2 n/a
4 TRCN0000425509 GCTTATATGGCCCTAATATTG pLKO_005 581 CDS 100% 13.200 9.240 N HPSE2 n/a
5 TRCN0000162222 CGAAGTGATGTTGCCTTAGAT pLKO.1 139 5UTR 100% 5.625 3.938 N HPSE2 n/a
6 TRCN0000158426 CCAAAGAGACTAAATGTCATA pLKO.1 1602 3UTR 100% 4.950 3.465 N HPSE2 n/a
7 TRCN0000204533 CCTCCCAAAGTGCTGGAATTA pLKO.1 25 5UTR 100% 13.200 6.600 Y LRRC74B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011540031.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08799 pDONR223 100% 70.8% 70.6% None 0_1ins516;1024G>A;1220A>T n/a
2 ccsbBroad304_08799 pLX_304 0% 70.8% 70.6% V5 0_1ins516;1024G>A;1220A>T n/a
3 TRCN0000475450 ACTGCCGATATAGAACTCCATGTA pLX_317 23.1% 70.8% 70.6% V5 0_1ins516;1024G>A;1220A>T n/a
Download CSV