Transcript: Human XM_011540268.1

PREDICTED: Homo sapiens DPY30 domain containing 2 (DYDC2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DYDC2 (84332)
Length:
1685
CDS:
30..563

Additional Resources:

NCBI RefSeq record:
XM_011540268.1
NBCI Gene record:
DYDC2 (84332)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011540268.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000145553 CAGATTGACCAGAACTTCAAA pLKO.1 459 CDS 100% 5.625 3.938 N DYDC2 n/a
2 TRCN0000121769 CAGGAAGAGTATCAGATTCAA pLKO.1 255 CDS 100% 5.625 3.938 N DYDC2 n/a
3 TRCN0000121561 CAGATTCAACAGAACTGTGAA pLKO.1 267 CDS 100% 4.950 3.465 N DYDC2 n/a
4 TRCN0000144888 GAAACAGGAAGAGTATCAGAT pLKO.1 251 CDS 100% 4.950 3.465 N DYDC2 n/a
5 TRCN0000142609 GATTCCAGGAATGCCTCAACA pLKO.1 413 CDS 100% 4.950 3.465 N DYDC2 n/a
6 TRCN0000141084 CAGTAGCCTCAAGGAAATGGA pLKO.1 215 CDS 100% 3.000 2.100 N DYDC2 n/a
7 TRCN0000142793 CAATAGAATACCTGGCTCACT pLKO.1 115 CDS 100% 2.640 1.848 N DYDC2 n/a
8 TRCN0000143765 CACAAGGAACTGACTTCTGAA pLKO.1 294 CDS 100% 4.950 2.970 N DYDC2 n/a
9 TRCN0000141323 CCATATTCATGCAGGAGGACA pLKO.1 334 CDS 100% 2.640 1.584 N DYDC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011540268.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04382 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04382 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474541 TTTATCAGGATCAGTTTGGACCCC pLX_317 67.6% 100% 100% V5 n/a
Download CSV