Transcript: Human XM_011540293.2

PREDICTED: Homo sapiens pyridine nucleotide-disulphide oxidoreductase domain 2 (PYROXD2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PYROXD2 (84795)
Length:
3487
CDS:
1407..3254

Additional Resources:

NCBI RefSeq record:
XM_011540293.2
NBCI Gene record:
PYROXD2 (84795)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011540293.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419431 TTGATTGCATCGAGGTCTATG pLKO_005 2959 CDS 100% 10.800 15.120 N PYROXD2 n/a
2 TRCN0000064397 GCCGCAGATTTACACTGATCT pLKO.1 1793 CDS 100% 4.950 6.930 N PYROXD2 n/a
3 TRCN0000064394 CCCGATATTATGAGGTCCTCA pLKO.1 2158 CDS 100% 2.640 3.696 N PYROXD2 n/a
4 TRCN0000064393 GCCCAGGTCTTTCCCAAATAT pLKO.1 1974 CDS 100% 15.000 10.500 N PYROXD2 n/a
5 TRCN0000438104 AGCAGGAGAGAGACGCTTATG pLKO_005 2926 CDS 100% 10.800 7.560 N PYROXD2 n/a
6 TRCN0000064396 CAAGGAGTTGTGCTGGAAGAT pLKO.1 2475 CDS 100% 4.950 3.465 N PYROXD2 n/a
7 TRCN0000064395 CACCACCAGATTTGGAGAGAA pLKO.1 3022 CDS 100% 4.950 3.465 N PYROXD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011540293.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09223 pDONR223 100% 91.8% 88.9% None (many diffs) n/a
2 ccsbBroad304_09223 pLX_304 0% 91.8% 88.9% V5 (many diffs) n/a
3 TRCN0000468691 AGTACTCCTAGATACCCCTTAACC pLX_317 24.8% 91.8% 88.9% V5 (many diffs) n/a
Download CSV