Transcript: Human XM_011540376.2

PREDICTED: Homo sapiens ectonucleoside triphosphate diphosphohydrolase 1 (ENTPD1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ENTPD1 (953)
Length:
3015
CDS:
69..1361

Additional Resources:

NCBI RefSeq record:
XM_011540376.2
NBCI Gene record:
ENTPD1 (953)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011540376.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050291 CCCAGATAATGCTCTGCAATT pLKO.1 821 CDS 100% 10.800 15.120 N ENTPD1 n/a
2 TRCN0000257193 GCACCAAGAGACACCCGTTTA pLKO_005 485 CDS 100% 10.800 15.120 N ENTPD1 n/a
3 TRCN0000219070 GACATTCAGGTTGCAAGTAAT pLKO_005 930 CDS 100% 13.200 9.240 N ENTPD1 n/a
4 TRCN0000230634 TGCTTTCATCCTGGATATAAG pLKO_005 969 CDS 100% 13.200 9.240 N ENTPD1 n/a
5 TRCN0000230633 GCCTATGGCTGGATTACTATC pLKO_005 651 CDS 100% 10.800 7.560 N ENTPD1 n/a
6 TRCN0000050289 GCAGTTTGAAATCCAGGGTAT pLKO.1 1061 CDS 100% 4.050 2.835 N ENTPD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011540376.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488654 TTACAATCACTTAGGGAGTACATA pLX_317 23.7% 67.4% 56.6% V5 (many diffs) n/a
2 TRCN0000488171 TCATCTCCCGTACCTCATGACTTG pLX_317 20.5% 67.3% 56.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV