Transcript: Human XM_011540535.2

PREDICTED: Homo sapiens adenosylhomocysteinase like 1 (AHCYL1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AHCYL1 (10768)
Length:
3536
CDS:
3..1520

Additional Resources:

NCBI RefSeq record:
XM_011540535.2
NBCI Gene record:
AHCYL1 (10768)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011540535.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051453 GCACTGATAGAACTCTATAAT pLKO.1 1395 CDS 100% 15.000 21.000 N AHCYL1 n/a
2 TRCN0000299611 GCACTGATAGAACTCTATAAT pLKO_005 1395 CDS 100% 15.000 21.000 N AHCYL1 n/a
3 TRCN0000051454 CGGCAAGTCGATGTCGTAATA pLKO.1 1095 CDS 100% 13.200 18.480 N AHCYL1 n/a
4 TRCN0000299610 CGGCAAGTCGATGTCGTAATA pLKO_005 1095 CDS 100% 13.200 18.480 N AHCYL1 n/a
5 TRCN0000303728 CAATGTCTAAATCGCCTTAAA pLKO_005 1823 3UTR 100% 13.200 10.560 N AHCYL1 n/a
6 TRCN0000314193 GAAGTATCCAAACGTGTTTAA pLKO_005 719 CDS 100% 13.200 9.240 N Ahcyl1 n/a
7 TRCN0000051457 GATGTGATGTTTGGTGGGAAA pLKO.1 918 CDS 100% 4.050 2.835 N AHCYL1 n/a
8 TRCN0000310439 GATGTGATGTTTGGTGGGAAA pLKO_005 918 CDS 100% 4.050 2.835 N AHCYL1 n/a
9 TRCN0000303727 GAGGGTCGTCTACTCAATTTG pLKO_005 1317 CDS 100% 13.200 7.920 N AHCYL1 n/a
10 TRCN0000051456 CAGCAGCAATTTCTGTGTGAA pLKO.1 305 CDS 100% 4.950 2.970 N AHCYL1 n/a
11 TRCN0000101597 GCTCTGATTTCACTCAGGAAA pLKO.1 387 CDS 100% 4.950 2.970 N Ahcyl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011540535.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02522 pDONR223 100% 93.9% 92.3% None (many diffs) n/a
2 ccsbBroad304_02522 pLX_304 0% 93.9% 92.3% V5 (many diffs) n/a
3 TRCN0000479541 CTCCGAGCAGCTAGTGTGTACACC pLX_317 23.3% 93.9% 92.3% V5 (many diffs) n/a
4 ccsbBroadEn_11546 pDONR223 100% 88.3% 86.7% None (many diffs) n/a
5 ccsbBroad304_11546 pLX_304 0% 88.3% 86.7% V5 (many diffs) n/a
6 TRCN0000478243 TCTTTAAGGATATACCGATCACAC pLX_317 17.6% 88.3% 86.7% V5 (many diffs) n/a
Download CSV