Transcript: Human XM_011540541.2

PREDICTED: Homo sapiens kinesin family member 2C (KIF2C), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIF2C (11004)
Length:
3052
CDS:
643..2481

Additional Resources:

NCBI RefSeq record:
XM_011540541.2
NBCI Gene record:
KIF2C (11004)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011540541.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108297 GCCCGAATGATTAAAGAATTT pLKO.1 1000 CDS 100% 13.200 10.560 N KIF2C n/a
2 TRCN0000299994 GCCCGAATGATTAAAGAATTT pLKO_005 1000 CDS 100% 13.200 10.560 N KIF2C n/a
3 TRCN0000108295 GCACTGAATGTCTTGTACTTT pLKO.1 2905 3UTR 100% 5.625 3.938 N KIF2C n/a
4 TRCN0000299995 GCACTGAATGTCTTGTACTTT pLKO_005 2905 3UTR 100% 5.625 3.938 N KIF2C n/a
5 TRCN0000108296 GCCCACTGAATAAGCAAGAAT pLKO.1 1100 CDS 100% 5.625 3.938 N KIF2C n/a
6 TRCN0000108299 CCCAAGTTGAAAGTGGACTTA pLKO.1 1183 CDS 100% 4.950 3.465 N KIF2C n/a
7 TRCN0000299993 CCCAAGTTGAAAGTGGACTTA pLKO_005 1183 CDS 100% 4.950 3.465 N KIF2C n/a
8 TRCN0000108298 CGCCCACTGAATAAGCAAGAA pLKO.1 1099 CDS 100% 4.950 3.465 N KIF2C n/a
9 TRCN0000300064 CGCCCACTGAATAAGCAAGAA pLKO_005 1099 CDS 100% 4.950 3.465 N KIF2C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011540541.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02592 pDONR223 100% 84.4% 84.4% None 0_1ins339 n/a
2 ccsbBroad304_02592 pLX_304 0% 84.4% 84.4% V5 0_1ins339 n/a
3 TRCN0000480440 TACGACTGACCCATACTCTTCGAT pLX_317 20.5% 84.4% 84.4% V5 0_1ins339 n/a
4 TRCN0000492255 CGGCCTCCTGGCAGCAATACTTCG pLX_317 4.6% 84.4% 84.4% V5 (not translated due to prior stop codon) 0_1ins339 n/a
5 ccsbBroadEn_07722 pDONR223 100% 84.3% 84.2% None 0_1ins339;1754G>C n/a
6 ccsbBroad304_07722 pLX_304 0% 84.3% 84.2% V5 0_1ins339;1754G>C n/a
Download CSV