Transcript: Human XM_011540571.3

PREDICTED: Homo sapiens erythroblast membrane associated protein (Scianna blood group) (ERMAP), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ERMAP (114625)
Length:
3414
CDS:
254..1660

Additional Resources:

NCBI RefSeq record:
XM_011540571.3
NBCI Gene record:
ERMAP (114625)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011540571.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152804 GAAGATCTGATGCCGGAATAT pLKO.1 515 CDS 100% 13.200 9.240 N ERMAP n/a
2 TRCN0000154254 CCTCAAGGTGAACTCTTCTTT pLKO.1 1543 CDS 100% 5.625 3.938 N ERMAP n/a
3 TRCN0000150989 CCAAATGGATTCTTGGAGTAT pLKO.1 1140 CDS 100% 4.950 3.465 N ERMAP n/a
4 TRCN0000152411 CTGGAAGCAAAGAAGAGCAAA pLKO.1 781 CDS 100% 4.950 3.465 N ERMAP n/a
5 TRCN0000153129 GATTTCGTTGTCAGCATCCTA pLKO.1 1061 CDS 100% 3.000 2.100 N ERMAP n/a
6 TRCN0000158346 CTTCTCATCATGGTGTGCCTT pLKO.1 752 CDS 100% 2.640 1.848 N ERMAP n/a
7 TRCN0000151163 GAAGGATATAATCCTGTCCTT pLKO.1 1588 CDS 100% 0.264 0.185 N ERMAP n/a
8 TRCN0000153980 CCCAGAGCTGAAGGATATAAT pLKO.1 1579 CDS 100% 15.000 9.000 N ERMAP n/a
9 TRCN0000154104 CCTTTCTTTGAACCTTGCCTT pLKO.1 1409 CDS 100% 2.640 1.584 N ERMAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011540571.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04658 pDONR223 100% 98.5% 98.5% None 636_637ins21 n/a
2 ccsbBroad304_04658 pLX_304 0% 98.5% 98.5% V5 636_637ins21 n/a
3 TRCN0000478655 TCTGCCCTTCGATCAACTAGAATC pLX_317 19.2% 98.5% 98.5% V5 636_637ins21 n/a
Download CSV