Transcript: Human XM_011540622.2

PREDICTED: Homo sapiens keratinocyte differentiation factor 1 (KDF1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KDF1 (126695)
Length:
1830
CDS:
121..1317

Additional Resources:

NCBI RefSeq record:
XM_011540622.2
NBCI Gene record:
KDF1 (126695)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011540622.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122804 GCGGCATCATTCGCATTAGTA pLKO.1 1016 CDS 100% 5.625 4.500 N KDF1 n/a
2 TRCN0000142246 GAGCCGAGAAATTGATGTGCT pLKO.1 825 CDS 100% 2.640 2.112 N KDF1 n/a
3 TRCN0000141573 CCAGTAAGATCTCGGACCTTA pLKO.1 935 CDS 100% 4.950 3.465 N KDF1 n/a
4 TRCN0000142228 GCATTACCTTCTGGGAGTGAA pLKO.1 1595 3UTR 100% 4.950 3.465 N KDF1 n/a
5 TRCN0000144941 GAAAGTAAGGAGTTAGGCATT pLKO.1 1579 3UTR 100% 4.050 2.835 N KDF1 n/a
6 TRCN0000144641 GATCATGGAAAGTAAGGAGTT pLKO.1 1572 3UTR 100% 4.050 2.835 N KDF1 n/a
7 TRCN0000141425 CCACCCTAACCAATCATGCAA pLKO.1 1638 3UTR 100% 3.000 2.100 N KDF1 n/a
8 TRCN0000145419 GAGGAGTACTATTCTTTCCAT pLKO.1 760 CDS 100% 3.000 2.100 N KDF1 n/a
9 TRCN0000141086 CAGAGCTATGTCTGGAGACAT pLKO.1 188 CDS 100% 0.495 0.347 N KDF1 n/a
10 TRCN0000141928 CAAGAAGCTGACAGAGCTGTT pLKO.1 852 CDS 100% 4.050 2.430 N KDF1 n/a
11 TRCN0000142229 GCATTACCTTCATCTCTGGCT pLKO.1 290 CDS 100% 0.660 0.396 N KDF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011540622.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13119 pDONR223 100% 61.3% 61.3% None 1_462del n/a
2 ccsbBroad304_13119 pLX_304 0% 61.3% 61.3% V5 1_462del n/a
3 TRCN0000475889 AACCGAACTCAGTTATTAGGGGTA pLX_317 42% 61.3% 61.3% V5 1_462del n/a
Download CSV