Transcript: Human XM_011541185.3

PREDICTED: Homo sapiens transmembrane and coiled-coil domains 4 (TMCO4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMCO4 (255104)
Length:
3112
CDS:
381..2285

Additional Resources:

NCBI RefSeq record:
XM_011541185.3
NBCI Gene record:
TMCO4 (255104)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541185.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412290 ATCTCCCTGTCCCAGTTATTT pLKO_005 522 CDS 100% 15.000 10.500 N TMCO4 n/a
2 TRCN0000430085 CGGAGGAAATGGAAGCGTTAT pLKO_005 930 CDS 100% 10.800 7.560 N TMCO4 n/a
3 TRCN0000127824 GCATCCCGAAAGAAGAAAGAA pLKO.1 906 CDS 100% 5.625 3.938 N TMCO4 n/a
4 TRCN0000128110 CCTGACAGGATACAAGATGAA pLKO.1 1130 CDS 100% 4.950 3.465 N TMCO4 n/a
5 TRCN0000129357 CTCCTTCTGCACAGAGTTCAT pLKO.1 560 CDS 100% 4.950 3.465 N TMCO4 n/a
6 TRCN0000129375 GAGTCAACCAAGCACAGGTTA pLKO.1 2542 3UTR 100% 4.950 3.465 N TMCO4 n/a
7 TRCN0000130795 GCCATTGAAGAGTTCACGTTT pLKO.1 1164 CDS 100% 4.950 3.465 N TMCO4 n/a
8 TRCN0000129707 CCTAAATGGAAGGAATTGGAA pLKO.1 2397 3UTR 100% 3.000 2.100 N TMCO4 n/a
9 TRCN0000129432 GCCAGAGTCATCTACTTCTGT pLKO.1 1599 CDS 100% 3.000 2.100 N TMCO4 n/a
10 TRCN0000130796 GCATGGTGAATACATGCTGAA pLKO.1 2948 3UTR 100% 0.405 0.284 N TMCO4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541185.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09906 pDONR223 100% 99.8% 99.6% None 1433_1434delGTinsAC;1717T>N n/a
2 ccsbBroad304_09906 pLX_304 0% 99.8% 99.6% V5 1433_1434delGTinsAC;1717T>N n/a
Download CSV