Transcript: Human XM_011541225.2

PREDICTED: Homo sapiens protein tyrosine phosphatase non-receptor type 22 (PTPN22), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTPN22 (26191)
Length:
3553
CDS:
139..2388

Additional Resources:

NCBI RefSeq record:
XM_011541225.2
NBCI Gene record:
PTPN22 (26191)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541225.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000355534 CTCGAACTATCTACCAGTTTC pLKO_005 611 CDS 100% 10.800 7.560 N PTPN22 n/a
2 TRCN0000355533 TCTAAACACCAAATACGTAAT pLKO_005 1579 CDS 100% 10.800 7.560 N PTPN22 n/a
3 TRCN0000003038 GAATTGATACAGCAGAGAGAA pLKO.1 1423 CDS 100% 4.950 3.465 N PTPN22 n/a
4 TRCN0000003034 GACTGGTGTTATTTGTGCTAT pLKO.1 765 CDS 100% 4.950 3.465 N PTPN22 n/a
5 TRCN0000003037 CTAGTGCTCTTGGTGTATATT pLKO.1 1625 CDS 100% 0.000 0.000 N PTPN22 n/a
6 TRCN0000003035 CAGAGAGTCAAGCAAAGCATT pLKO.1 977 CDS 100% 4.950 2.970 N PTPN22 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541225.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11820 pDONR223 100% 22.8% 21.2% None (many diffs) n/a
2 ccsbBroad304_11820 pLX_304 0% 22.8% 21.2% V5 (many diffs) n/a
3 TRCN0000469063 TGAGAAGTGGGTAGGCCCGGTTAA pLX_317 56.9% 22.8% 21.2% V5 (many diffs) n/a
4 TRCN0000491802 GTTCAGTCTTTCAGAGAATAGACC pLX_317 60.2% 22.8% 21.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV