Transcript: Human XM_011541401.3

PREDICTED: Homo sapiens potassium voltage-gated channel subfamily C member 4 (KCNC4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KCNC4 (3749)
Length:
2563
CDS:
707..2536

Additional Resources:

NCBI RefSeq record:
XM_011541401.3
NBCI Gene record:
KCNC4 (3749)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541401.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044941 CGTCGGAGAAGATCATCATCA pLKO.1 807 CDS 100% 4.950 6.930 N KCNC4 n/a
2 TRCN0000044942 GACTCTAAGCAGAATGGCGAT pLKO.1 2321 CDS 100% 2.160 3.024 N KCNC4 n/a
3 TRCN0000044940 GAGACCCATGAGGCCTTTAAT pLKO.1 1442 CDS 100% 15.000 10.500 N KCNC4 n/a
4 TRCN0000420126 CACGCTGGACTTCGTCAAGAA pLKO_005 1621 CDS 100% 4.950 3.465 N KCNC4 n/a
5 TRCN0000044938 GAGGGTATGATCGAGAGGAAA pLKO.1 2294 CDS 100% 4.950 3.465 N KCNC4 n/a
6 TRCN0000069035 GTCGGAGAAGATCATCATCAA pLKO.1 808 CDS 100% 4.950 3.465 N Kcnc4 n/a
7 TRCN0000044939 CCAATGAGTTCCTGCTGCTTA pLKO.1 1839 CDS 100% 4.950 2.970 N KCNC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541401.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488393 CCCAGCTCGCCGCAGATGCAGCCA pLX_317 18.7% 95.7% 95.5% V5 (not translated due to prior stop codon) 1823_1825delAGAinsCAT;1827_1828ins78 n/a
2 TRCN0000487938 CACTCCCCATTACGCCACTCGACG pLX_317 16.8% 95.6% 95.4% V5 1823_1825delAGAinsCAT;1827_1828ins79 n/a
3 ccsbBroadEn_10931 pDONR223 100% 90.8% 86.1% None (many diffs) n/a
4 ccsbBroad304_10931 pLX_304 0% 90.8% 86.1% V5 (many diffs) n/a
5 TRCN0000477692 ATGTGGAAGGGACAAGAACCGTAC pLX_317 23.5% 90.8% 86.1% V5 (many diffs) n/a
Download CSV