Transcript: Human XM_011541463.2

PREDICTED: Homo sapiens non-compact myelin associated protein (NCMAP), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NCMAP (400746)
Length:
2504
CDS:
899..1207

Additional Resources:

NCBI RefSeq record:
XM_011541463.2
NBCI Gene record:
NCMAP (400746)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541463.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000439195 ATCATCTTCACCGTGGTTCTG pLKO_005 1022 CDS 100% 4.050 5.670 N NCMAP n/a
2 TRCN0000416066 ACTGCTGAGAGTATCACAATA pLKO_005 1553 3UTR 100% 13.200 9.240 N NCMAP n/a
3 TRCN0000437372 AGGTCGACAGAGACATCTTTG pLKO_005 1310 3UTR 100% 10.800 7.560 N NCMAP n/a
4 TRCN0000161831 GAGAAGACTTCCTGTATAAGA pLKO.1 960 CDS 100% 5.625 3.938 N NCMAP n/a
5 TRCN0000164009 CCTTCTTCTCACTGAACATGA pLKO.1 930 CDS 100% 4.950 3.465 N NCMAP n/a
6 TRCN0000162209 CTGAAGATGTACAACAGGAAA pLKO.1 1049 CDS 100% 4.950 3.465 N NCMAP n/a
7 TRCN0000265043 GATCCTGCTGAAGATGTACAA pLKO_005 1042 CDS 100% 4.950 3.465 N Ncmap n/a
8 TRCN0000436202 TGCCGTTGTGGTGGTTGTCAT pLKO_005 1000 CDS 100% 4.950 3.465 N NCMAP n/a
9 TRCN0000163334 GCTGAAGATGTACAACAGGAA pLKO.1 1048 CDS 100% 2.640 1.848 N NCMAP n/a
10 TRCN0000163410 GTATAAGAGTTCTGGAGCCAT pLKO.1 973 CDS 100% 2.640 1.848 N NCMAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541463.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05638 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05638 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468485 CGCGGGCGGCACTGTACAGTGTGG pLX_317 100% 100% 100% V5 n/a
Download CSV