Transcript: Human XM_011541526.1

PREDICTED: Homo sapiens receptor tyrosine kinase like orphan receptor 1 (ROR1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ROR1 (4919)
Length:
5422
CDS:
188..2812

Additional Resources:

NCBI RefSeq record:
XM_011541526.1
NBCI Gene record:
ROR1 (4919)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541526.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002024 CTTTACTAGGAGACGCCAATA pLKO.1 2751 CDS 100% 10.800 15.120 N ROR1 n/a
2 TRCN0000320775 CTTTACTAGGAGACGCCAATA pLKO_005 2751 CDS 100% 10.800 15.120 N ROR1 n/a
3 TRCN0000002028 CGGAGAGCAACTTCATGTAAA pLKO.1 1867 CDS 100% 13.200 10.560 N ROR1 n/a
4 TRCN0000320699 CGGAGAGCAACTTCATGTAAA pLKO_005 1867 CDS 100% 13.200 10.560 N ROR1 n/a
5 TRCN0000195189 CAAGATCAAATCCCATGATTC pLKO.1 798 CDS 100% 10.800 7.560 N ROR1 n/a
6 TRCN0000023363 CCCATCAATGGATACCCAATA pLKO.1 2450 CDS 100% 10.800 7.560 N Ror1 n/a
7 TRCN0000199999 CTTCCCGTACTGCGATGAAAC pLKO.1 691 CDS 100% 10.800 7.560 N ROR1 n/a
8 TRCN0000002027 CATTGCTTTACTCTTCTTCTT pLKO.1 1249 CDS 100% 4.950 3.465 N ROR1 n/a
9 TRCN0000002026 GCACCGTCTATATGGAGTCTT pLKO.1 552 CDS 100% 4.950 3.465 N ROR1 n/a
10 TRCN0000320698 GCACCGTCTATATGGAGTCTT pLKO_005 552 CDS 100% 4.950 3.465 N ROR1 n/a
11 TRCN0000002025 CTCATTTAGCAGACATCGCAA pLKO.1 2903 3UTR 100% 2.640 1.848 N ROR1 n/a
12 TRCN0000320776 CTCATTTAGCAGACATCGCAA pLKO_005 2903 3UTR 100% 2.640 1.848 N ROR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541526.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488715 TGTGTCTGTAGTAGCGGAGAAAGC pLX_317 12.3% 93.2% 93.1% V5 (not translated due to prior stop codon) 0_1ins189;981G>T;1364C>T n/a
2 TRCN0000487763 TGGCAACCAATATTGTTATAACTT pLX_317 10.9% 93.2% 93.1% V5 (not translated due to prior stop codon) 0_1ins189;981G>T;1364C>T n/a
3 TRCN0000488851 TACCTGTAAGTTTTTTTTCATAAA pLX_317 12% 93.1% 93% V5 (many diffs) n/a
Download CSV