Transcript: Human XM_011541727.3

PREDICTED: Homo sapiens enoyl-CoA hydratase domain containing 2 (ECHDC2), transcript variant X20, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ECHDC2 (55268)
Length:
4198
CDS:
3139..3807

Additional Resources:

NCBI RefSeq record:
XM_011541727.3
NBCI Gene record:
ECHDC2 (55268)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541727.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438145 AGTAGCCATTGACCGAGGAAC pLKO_005 3579 CDS 100% 4.050 5.670 N ECHDC2 n/a
2 TRCN0000446499 TTGCATCTGGGATGGCCATTG pLKO_005 3786 CDS 100% 6.000 4.200 N ECHDC2 n/a
3 TRCN0000439847 GAGCGGGAACAGATGAGTGAA pLKO_005 3292 CDS 100% 4.950 3.465 N ECHDC2 n/a
4 TRCN0000036977 GATCACTGAGATTCTGATGAA pLKO.1 3123 5UTR 100% 4.950 3.465 N ECHDC2 n/a
5 TRCN0000036976 GCTCTTCAGAAGTGGAGTGAA pLKO.1 3240 CDS 100% 4.950 3.465 N ECHDC2 n/a
6 TRCN0000447254 GGGAATGTCTTCGTCAGTGAG pLKO_005 3169 CDS 100% 4.050 2.835 N ECHDC2 n/a
7 TRCN0000036978 GACTCCCAAATTTGTTGGCAA pLKO.1 3880 3UTR 100% 2.640 1.848 N ECHDC2 n/a
8 TRCN0000036975 GCTGGGCAAAGTAGCCATTAA pLKO.1 3570 CDS 100% 13.200 9.240 N ECHDC2 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 32 5UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 32 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541727.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08500 pDONR223 100% 54.6% 48.1% None (many diffs) n/a
2 ccsbBroad304_08500 pLX_304 0% 54.6% 48.1% V5 (many diffs) n/a
3 TRCN0000468030 CATCTCCCAAGAGGATTAGTACTA pLX_317 49.3% 54.6% 48.1% V5 (many diffs) n/a
Download CSV