Transcript: Human XM_011541740.2

PREDICTED: Homo sapiens mucolipin 3 (MCOLN3), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MCOLN3 (55283)
Length:
2608
CDS:
2..1567

Additional Resources:

NCBI RefSeq record:
XM_011541740.2
NBCI Gene record:
MCOLN3 (55283)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541740.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416641 TTGACAATCATTGGATCAATT pLKO_005 956 CDS 100% 13.200 10.560 N MCOLN3 n/a
2 TRCN0000428091 GATGACCCTCCAGTATCTTTA pLKO_005 1526 CDS 100% 13.200 9.240 N MCOLN3 n/a
3 TRCN0000074311 CCATGGAAACTTGCCATACAA pLKO.1 251 CDS 100% 5.625 3.938 N MCOLN3 n/a
4 TRCN0000074309 CTGGCATGTATCTGGATCAAT pLKO.1 718 CDS 100% 5.625 3.938 N MCOLN3 n/a
5 TRCN0000074310 GAACACTCATTACATGATGAT pLKO.1 745 CDS 100% 4.950 3.465 N MCOLN3 n/a
6 TRCN0000074308 GCACCAGCTAACAATGTGATA pLKO.1 2097 3UTR 100% 4.950 3.465 N MCOLN3 n/a
7 TRCN0000430431 GAGTGGGTGTAGTTATCATTT pLKO_005 1992 3UTR 100% 13.200 7.920 N MCOLN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541740.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12197 pDONR223 100% 45.6% 44.5% None (many diffs) n/a
2 ccsbBroad304_12197 pLX_304 0% 45.6% 44.5% V5 (many diffs) n/a
3 TRCN0000478835 GCCATGTGATAGAGAATTGTTCGG pLX_317 45.7% 45.6% 44.5% V5 (many diffs) n/a
Download CSV