Construct: ORF TRCN0000478835
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018103.2_s317c1
- Derived from:
- ccsbBroadEn_12197
- DNA Barcode:
- GCCATGTGATAGAGAATTGTTCGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MCOLN3 (55283)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478835
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55283 | MCOLN3 | mucolipin 3 | XM_011541741.2 | 71.7% | 70.1% | (many diffs) |
| 2 | human | 55283 | MCOLN3 | mucolipin 3 | NM_018298.11 | 57.7% | 56.5% | (many diffs) |
| 3 | human | 55283 | MCOLN3 | mucolipin 3 | XM_005271003.1 | 57.7% | 56.5% | (many diffs) |
| 4 | human | 55283 | MCOLN3 | mucolipin 3 | XM_006710750.1 | 57.7% | 56.5% | (many diffs) |
| 5 | human | 55283 | MCOLN3 | mucolipin 3 | XM_011541739.2 | 56.4% | 55.2% | (many diffs) |
| 6 | human | 55283 | MCOLN3 | mucolipin 3 | NM_001253693.1 | 47.6% | 46.4% | (many diffs) |
| 7 | human | 55283 | MCOLN3 | mucolipin 3 | XM_011541740.2 | 45.6% | 44.5% | (many diffs) |
| 8 | human | 55283 | MCOLN3 | mucolipin 3 | XM_011541742.1 | 29.7% | 28.7% | (many diffs) |
| 9 | human | 55283 | MCOLN3 | mucolipin 3 | XR_946699.2 | 15.5% | (many diffs) | |
| 10 | mouse | 171166 | Mcoln3 | mucolipin 3 | XM_006501085.2 | 55.6% | 57.3% | (many diffs) |
| 11 | mouse | 171166 | Mcoln3 | mucolipin 3 | NM_134160.1 | 48.7% | 50.2% | (many diffs) |
| 12 | mouse | 171166 | Mcoln3 | mucolipin 3 | XM_006501081.2 | 48.7% | 50.2% | (many diffs) |
| 13 | mouse | 171166 | Mcoln3 | mucolipin 3 | XM_006501082.3 | 48.7% | 50.2% | (many diffs) |
| 14 | mouse | 171166 | Mcoln3 | mucolipin 3 | XM_006501083.3 | 48.7% | 50.2% | (many diffs) |
| 15 | mouse | 171166 | Mcoln3 | mucolipin 3 | XM_006501084.3 | 48.7% | 50.2% | (many diffs) |
| 16 | mouse | 171166 | Mcoln3 | mucolipin 3 | XM_006501086.3 | 36% | 37.7% | (many diffs) |
| 17 | mouse | 171166 | Mcoln3 | mucolipin 3 | XM_006501087.3 | 36% | 37.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1029
- ORF length:
- 963
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc agatcctgag gtagttgtga gtagctgcag ctctcatgaa gaggaaaatc 121 gctgcaattt taaccagcaa acatctccat ctgaggagct tctattagaa gaccagatga 181 ggcgaaaact caaatttttt ttcatgaatc cctgtgagaa gttctgggct cgaggtagaa 241 aaccatggaa acttgccata caaattctaa aaattgcaat ggtgactatc cagctggtct 301 tatttgggct aagtaaccag atggtggtag ctttcaagga agagaatact atagcattca 361 aacacctttt cctaaaagga tatatggacc gaatggatga cacatatgca gtgtacacac 421 aaagtgacgt gtatgatcag ttaatcttcg cagtaaacca gtacttgcag ctatacaatg 481 tctccgttgg gaatcatgct tatgagaaca aaggtaccaa gcaatctgct atggcaatct 541 gtcagcactt atacaagcga ggaaacatct accctggaaa tgataccttT GACATCGATC 601 CAGAAATTGA AACTGAGTGT TTCTTTGTGG AGCCAGATGA ACCTTTTCAC ATTGGGACAC 661 CAGCAGAAAA TAAACTGAAC TTAACACTGG ACTTCCACAG ACTCCTAACA GTGGAGCTTC 721 AGTTTAAACT GAAAGCCATT AATCTGCAGA CAGTTCGTCA TCAAGAACTC CCTGACTGTT 781 ATGACTTTAC TCTGACTATA ACATTTGACA ACAAGGCCCA TAGTGGAAGA ATTAAAATAA 841 GTTTAGATAA TGACATTTCC ATCAGAGAAT GTAAAGACTG GCATGTATCT GGATCAATTC 901 AGAAGAACAC TCATTACATG ATGATCTTTG ATGCCTTTGT CATTCTGACT TGCTTGGTTT 961 CATTAATCCT CTGCATTAGA TCTGTGATTA GAGGACTTCA GCTTCAGCAG GTAGGGAACG 1021 TTGCTTTCTA CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1081 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1141 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAGCCATG TGATAGAGAA TTGTTCGGAC 1201 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt