Transcript: Human XM_011541826.3

PREDICTED: Homo sapiens KIAA1324 (KIAA1324), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIAA1324 (57535)
Length:
3274
CDS:
79..3087

Additional Resources:

NCBI RefSeq record:
XM_011541826.3
NBCI Gene record:
KIAA1324 (57535)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541826.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167985 CGAGGCAATAATGTCCTCTAT pLKO.1 787 CDS 100% 4.950 6.930 N KIAA1324 n/a
2 TRCN0000263313 CTTGTCCTGCTGGTTACTATA pLKO_005 1889 CDS 100% 13.200 9.240 N KIAA1324 n/a
3 TRCN0000263310 GGGATCCAGAAGACTACTTAC pLKO_005 2698 CDS 100% 10.800 7.560 N KIAA1324 n/a
4 TRCN0000346011 GGGATCCAGAAGACTACTTAC pLKO_005 2698 CDS 100% 10.800 7.560 N 5330417C22Rik n/a
5 TRCN0000168851 GTCACTCTTTGGGAAGATCAA pLKO.1 3015 CDS 100% 4.950 3.465 N KIAA1324 n/a
6 TRCN0000263312 CAGCCTTGCTGATCGACTTAT pLKO_005 2358 CDS 100% 13.200 7.920 N KIAA1324 n/a
7 TRCN0000263311 AGTCCTATACCTACATCATTG pLKO_005 1682 CDS 100% 10.800 6.480 N KIAA1324 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541826.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12361 pDONR223 100% 89.1% 88.9% None (many diffs) n/a
2 ccsbBroad304_12361 pLX_304 0% 89.1% 88.9% V5 (many diffs) n/a
3 TRCN0000491786 TGGTACGGCATCTGGCAAGCATCC pLX_317 13% 89.1% 88.9% V5 (many diffs) n/a
4 ccsbBroadEn_14232 pDONR223 100% 63.5% 63.2% None (many diffs) n/a
5 TRCN0000492161 AGTGCTACATCAAGCCTTATCGAT pLX_317 18.5% 63.5% 63.2% V5 (many diffs) n/a
Download CSV