Transcript: Human XM_011541863.1

PREDICTED: Homo sapiens cache domain containing 1 (CACHD1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CACHD1 (57685)
Length:
5698
CDS:
779..4201

Additional Resources:

NCBI RefSeq record:
XM_011541863.1
NBCI Gene record:
CACHD1 (57685)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541863.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429483 ATCAGCAACACTCGGTTTATA pLKO_005 3860 CDS 100% 15.000 21.000 N CACHD1 n/a
2 TRCN0000427891 TCACTAGACCAGTGCTATAAG pLKO_005 1205 CDS 100% 13.200 18.480 N CACHD1 n/a
3 TRCN0000136576 CGTTACATAGCAACACCCAAT pLKO.1 2567 CDS 100% 4.050 5.670 N CACHD1 n/a
4 TRCN0000198802 CCGTTACATAGCAACACCCAA pLKO.1 2566 CDS 100% 2.640 3.696 N Cachd1 n/a
5 TRCN0000429900 TAGCTAATCCAGGGTTGATTT pLKO_005 2667 CDS 100% 13.200 9.240 N CACHD1 n/a
6 TRCN0000138738 CGTATGTCCAACCTGGAGAAT pLKO.1 3794 CDS 100% 4.950 3.465 N CACHD1 n/a
7 TRCN0000134677 GCAGAGGAATTTAAGAGGTTT pLKO.1 5025 3UTR 100% 4.950 3.465 N CACHD1 n/a
8 TRCN0000133959 CTCTGTAATGATTCTCACCTA pLKO.1 1498 CDS 100% 2.640 1.848 N CACHD1 n/a
9 TRCN0000138502 CCCAAGAAATGTCAGTGCGTA pLKO.1 3777 CDS 100% 2.640 1.584 N CACHD1 n/a
10 TRCN0000198328 GCTCTAAACGATGCATCTCAA pLKO.1 4698 3UTR 100% 4.950 6.930 N Cachd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541863.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14235 pDONR223 100% 85.7% 85.6% None (many diffs) n/a
2 ccsbBroad304_14235 pLX_304 0% 85.7% 85.6% V5 (many diffs) n/a
3 TRCN0000480127 AGGCGTCCGTGCTTCAGTTAAATC pLX_317 11.8% 85.7% 85.6% V5 (many diffs) n/a
Download CSV