Transcript: Human XM_011541869.1

PREDICTED: Homo sapiens grainyhead like transcription factor 3 (GRHL3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GRHL3 (57822)
Length:
2750
CDS:
250..1920

Additional Resources:

NCBI RefSeq record:
XM_011541869.1
NBCI Gene record:
GRHL3 (57822)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541869.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434000 CAAGGTGTTCATCGGCGTAAA pLKO_005 1155 CDS 100% 10.800 15.120 N GRHL3 n/a
2 TRCN0000419410 TGATGGTTGTCTTCGACAATG pLKO_005 959 CDS 100% 10.800 15.120 N GRHL3 n/a
3 TRCN0000017578 GCGAGGAATCTTAGTCAACAT pLKO.1 1800 CDS 100% 4.950 6.930 N GRHL3 n/a
4 TRCN0000426873 CCCAAGGAGAAGCGGATATTG pLKO_005 319 CDS 100% 13.200 9.240 N GRHL3 n/a
5 TRCN0000017579 CCACCACTGATATGTATGATA pLKO.1 608 CDS 100% 5.625 3.938 N GRHL3 n/a
6 TRCN0000017582 CCTGAAGAGAACATTTACAAA pLKO.1 1762 CDS 100% 5.625 3.938 N GRHL3 n/a
7 TRCN0000017581 GCCTTGAGCTTCCTCTATGAT pLKO.1 286 CDS 100% 5.625 3.938 N GRHL3 n/a
8 TRCN0000017580 GCTCAAGAAGAATAACCTGAT pLKO.1 489 CDS 100% 4.050 2.835 N GRHL3 n/a
9 TRCN0000433838 TACTACCATGGCATGGAATAT pLKO_005 379 CDS 100% 13.200 7.920 N GRHL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541869.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10212 pDONR223 100% 99.8% 99.8% None 1_3delATG n/a
2 ccsbBroad304_10212 pLX_304 0% 99.8% 99.8% V5 1_3delATG n/a
3 TRCN0000466452 CGTTCTAAGCAATTTTCCATACAT pLX_317 16.7% 99.8% 99.8% V5 1_3delATG n/a
Download CSV