Transcript: Human XM_011542189.1

PREDICTED: Homo sapiens DENN domain containing 2D (DENND2D), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DENND2D (79961)
Length:
2264
CDS:
586..1833

Additional Resources:

NCBI RefSeq record:
XM_011542189.1
NBCI Gene record:
DENND2D (79961)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542189.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243266 GGATGATTACGAGCCTATAAT pLKO_005 407 5UTR 100% 15.000 21.000 N DENND2D n/a
2 TRCN0000243263 TTGGATCCCTGGTATTGATTT pLKO_005 1990 3UTR 100% 13.200 18.480 N DENND2D n/a
3 TRCN0000168304 GCAGAACAAATCAACGAGCAT pLKO.1 1519 CDS 100% 2.640 2.112 N DENND2D n/a
4 TRCN0000243265 CTTCATGGTTGGAGTACAAAT pLKO_005 1329 CDS 100% 13.200 9.240 N DENND2D n/a
5 TRCN0000243262 TCAAGATTGTGGGCCATTATG pLKO_005 1568 CDS 100% 13.200 9.240 N DENND2D n/a
6 TRCN0000243264 AGCACTCTTTGCCCAACTTTG pLKO_005 325 5UTR 100% 10.800 7.560 N DENND2D n/a
7 TRCN0000166983 CCATTATGCTTCCTATATCAA pLKO.1 1581 CDS 100% 5.625 3.938 N DENND2D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542189.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04154 pDONR223 100% 79.7% 67.9% None (many diffs) n/a
2 ccsbBroad304_04154 pLX_304 0% 79.7% 67.9% V5 (many diffs) n/a
3 TRCN0000471945 CTACGATTTATAGTCTTTGTGACC pLX_317 29.2% 79.7% 67.9% V5 (many diffs) n/a
Download CSV