Transcript: Human XM_011542437.2

PREDICTED: Homo sapiens zinc finger FYVE-type containing 9 (ZFYVE9), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZFYVE9 (9372)
Length:
7044
CDS:
324..4601

Additional Resources:

NCBI RefSeq record:
XM_011542437.2
NBCI Gene record:
ZFYVE9 (9372)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542437.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255475 ACTAATTGGAAGTTGACTAAA pLKO_005 1521 CDS 100% 13.200 18.480 N ZFYVE9 n/a
2 TRCN0000255476 GCAGATGCAGGTCTAGATTTA pLKO_005 1650 CDS 100% 13.200 10.560 N ZFYVE9 n/a
3 TRCN0000057045 GCTGTCATTTAACCCTACTTT pLKO.1 461 CDS 100% 5.625 4.500 N ZFYVE9 n/a
4 TRCN0000255477 CAGATCTAGGGAGTCCAAATT pLKO_005 1228 CDS 100% 13.200 9.240 N ZFYVE9 n/a
5 TRCN0000057043 CCCAAATCATTTGCACTTTAA pLKO.1 4654 3UTR 100% 13.200 9.240 N ZFYVE9 n/a
6 TRCN0000255474 TCCGCTCCTCTCTCAAGATTT pLKO_005 4900 3UTR 100% 13.200 9.240 N ZFYVE9 n/a
7 TRCN0000057044 GCAGCCAAATTAACAATGAAT pLKO.1 2850 CDS 100% 5.625 3.938 N ZFYVE9 n/a
8 TRCN0000057047 CCCACTATTCAGTGTCAGATT pLKO.1 3584 CDS 100% 4.950 3.465 N ZFYVE9 n/a
9 TRCN0000057046 GCCATCTATCAGTGTTCCTTT pLKO.1 2030 CDS 100% 4.950 3.465 N ZFYVE9 n/a
10 TRCN0000281406 TACCAGCAGAGACGGATATTT pLKO_005 2938 CDS 100% 0.000 0.000 N ZFYVE9 n/a
11 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 5946 3UTR 100% 4.950 2.475 Y n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 6672 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 6672 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542437.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02153 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02153 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478273 AGACGTACTTTTCTTAATCCTTAG pLX_317 7.2% 100% 100% V5 n/a
Download CSV