Transcript: Human XM_011542571.2

PREDICTED: Homo sapiens galactosidase beta 1 like 3 (GLB1L3), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GLB1L3 (112937)
Length:
2119
CDS:
290..1933

Additional Resources:

NCBI RefSeq record:
XM_011542571.2
NBCI Gene record:
GLB1L3 (112937)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542571.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140920 CCACATATTTCGGGAAGCACT pLKO.1 1488 CDS 100% 2.640 3.696 N GLB1L3 n/a
2 TRCN0000145169 GAATAATAAGGACCTGCACAT pLKO.1 1897 CDS 100% 4.050 3.240 N GLB1L3 n/a
3 TRCN0000145480 GAGAACCTTCCCATAAACAAT pLKO.1 1748 CDS 100% 5.625 3.938 N GLB1L3 n/a
4 TRCN0000149722 GACAACCAACAAGAGCTTCAT pLKO.1 991 CDS 100% 4.950 3.465 N GLB1L3 n/a
5 TRCN0000140150 GAGGCTGGAGATTACACAGAA pLKO.1 1550 CDS 100% 4.950 3.465 N GLB1L3 n/a
6 TRCN0000145213 GATAGGGATTCTGAATGAGAA pLKO.1 1879 CDS 100% 4.950 3.465 N GLB1L3 n/a
7 TRCN0000146501 CAGGAAGAGAACTTCATGCTT pLKO.1 533 CDS 100% 3.000 2.100 N GLB1L3 n/a
8 TRCN0000149235 GTTACTGTTGAGGACAACCAA pLKO.1 979 CDS 100% 3.000 2.100 N GLB1L3 n/a
9 TRCN0000146823 CAGGATACTTTCAATCAGCTT pLKO.1 1274 CDS 100% 2.640 1.848 N GLB1L3 n/a
10 TRCN0000141496 CCTACTTAAATGAGCCAGTCA pLKO.1 1704 CDS 100% 2.640 1.848 N GLB1L3 n/a
11 TRCN0000148886 CTTCAATACTGTCACCACCTA pLKO.1 775 CDS 100% 2.640 1.848 N GLB1L3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542571.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13013 pDONR223 100% 55.4% 53% None (many diffs) n/a
2 ccsbBroad304_13013 pLX_304 0% 55.4% 53% V5 (many diffs) n/a
3 TRCN0000472278 ATCCCGCCTTGATTGCCGCTGTTT pLX_317 35.4% 55.4% 53% V5 (many diffs) n/a
4 ccsbBroadEn_13014 pDONR223 100% 26.7% 24.7% None (many diffs) n/a
5 ccsbBroad304_13014 pLX_304 0% 26.7% 24.7% V5 (many diffs) n/a
6 TRCN0000466890 AGCTAACGCTAGCCCCCCAGCATA pLX_317 62.8% 26.7% 24.7% V5 (many diffs) n/a
Download CSV