Transcript: Human XM_011542866.3

PREDICTED: Homo sapiens cell adhesion associated, oncogene regulated (CDON), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDON (50937)
Length:
8235
CDS:
312..4106

Additional Resources:

NCBI RefSeq record:
XM_011542866.3
NBCI Gene record:
CDON (50937)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542866.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073397 GCGATACTCAGATCATGCTAA pLKO.1 2827 CDS 100% 4.950 6.930 N CDON n/a
2 TRCN0000073394 GCCTTCAAAGTCGAATATAAA pLKO.1 2568 CDS 100% 15.000 12.000 N CDON n/a
3 TRCN0000415014 CAAAGCTGAGGTGCGCTATAA pLKO_005 755 CDS 100% 13.200 9.240 N CDON n/a
4 TRCN0000073396 CGGTGGATTCAAGCCAGTTAT pLKO.1 1511 CDS 100% 13.200 9.240 N CDON n/a
5 TRCN0000424732 CTCAAGTCCTGAGATCGAAAT pLKO_005 1660 CDS 100% 10.800 7.560 N CDON n/a
6 TRCN0000073395 GCTTCTGAATATCCTGTCAAA pLKO.1 3102 CDS 100% 4.950 3.465 N CDON n/a
7 TRCN0000073393 CCAGTCATGTTCCAACTTCAA pLKO.1 4121 3UTR 100% 4.950 2.475 Y CDON n/a
8 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 4749 3UTR 100% 4.950 2.475 Y LOC387873 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6457 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542866.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15058 pDONR223 90.1% 99.8% 99.6% None (many diffs) n/a
2 ccsbBroad304_15058 pLX_304 0% 99.8% 99.6% V5 (many diffs) n/a
3 TRCN0000478706 CGGTCATACCTACTTGGAGCCCTC pLX_317 10.1% 89.3% 89.3% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV