Transcript: Human XM_011542911.2

PREDICTED: Homo sapiens single-pass membrane protein with coiled-coil domains 4 (SMCO4), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SMCO4 (56935)
Length:
1665
CDS:
770..1267

Additional Resources:

NCBI RefSeq record:
XM_011542911.2
NBCI Gene record:
SMCO4 (56935)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542911.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000168176 CTTGATCGTGGTGTTTGTGTA pLKO.1 1076 CDS 100% 4.950 6.930 N SMCO4 n/a
2 TRCN0000141048 CGATAAGTAGCTCCACCTGAA pLKO.1 1446 3UTR 100% 4.050 3.240 N SMCO4 n/a
3 TRCN0000297884 CGATAAGTAGCTCCACCTGAA pLKO_005 1446 3UTR 100% 4.050 3.240 N SMCO4 n/a
4 TRCN0000167108 CTCTGGTCTTTGACTTGATTA pLKO.1 1255 CDS 100% 13.200 9.240 N SMCO4 n/a
5 TRCN0000280777 CTCTGGTCTTTGACTTGATTA pLKO_005 1255 CDS 100% 13.200 9.240 N SMCO4 n/a
6 TRCN0000168096 CTCACCTCATTCCCATTGTTT pLKO.1 1509 3UTR 100% 5.625 3.938 N SMCO4 n/a
7 TRCN0000280779 CTCACCTCATTCCCATTGTTT pLKO_005 1509 3UTR 100% 5.625 3.938 N SMCO4 n/a
8 TRCN0000167335 CATTCCCATTGTTTGGATCAT pLKO.1 1516 3UTR 100% 4.950 3.465 N SMCO4 n/a
9 TRCN0000168234 CATACACCTTATGGTCCACTT pLKO.1 1330 3UTR 100% 4.050 2.835 N SMCO4 n/a
10 TRCN0000122633 GCAGATCACTACAGTGGTGCT pLKO.1 1031 CDS 100% 2.160 1.512 N SMCO4 n/a
11 TRCN0000280706 GCAGATCACTACAGTGGTGCT pLKO_005 1031 CDS 100% 2.160 1.512 N SMCO4 n/a
12 TRCN0000257892 GAGACCTCCAAGGACAAGAAG pLKO_005 978 CDS 100% 4.950 2.970 N Smco4 n/a
13 TRCN0000122362 CAAGGACAAGAAGGAGCGGAA pLKO.1 986 CDS 100% 2.160 1.296 N SMCO4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542911.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08668 pDONR223 100% 35.5% 1.3% None 1_178del;280G>A;356_495del n/a
2 ccsbBroad304_08668 pLX_304 0% 35.5% 1.3% V5 1_178del;280G>A;356_495del n/a
3 TRCN0000466275 GACAACTTTTGTCCTCCGTTCTGC pLX_317 100% 35.5% 1.3% V5 1_178del;280G>A;356_495del n/a
Download CSV