Transcript: Human XM_011542978.3

PREDICTED: Homo sapiens family with sequence similarity 118 member B (FAM118B), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM118B (79607)
Length:
2087
CDS:
646..1236

Additional Resources:

NCBI RefSeq record:
XM_011542978.3
NBCI Gene record:
FAM118B (79607)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542978.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149644 GTTGCATATTCACGGAGTCTA pLKO.1 786 CDS 100% 4.950 6.930 N FAM118B n/a
2 TRCN0000148569 CCAGTAATGTTCGATCCACAT pLKO.1 478 5UTR 100% 4.050 5.670 N FAM118B n/a
3 TRCN0000176987 GTCAAGCATAAATCTGACCTA pLKO.1 976 CDS 100% 2.640 3.696 N Fam118b n/a
4 TRCN0000279484 GTCAAGCATAAATCTGACCTA pLKO_005 976 CDS 100% 2.640 3.696 N Fam118b n/a
5 TRCN0000148838 CTATGCCGATCTTCCAGAATA pLKO.1 1098 CDS 100% 13.200 9.240 N FAM118B n/a
6 TRCN0000197636 CATGACTTGAAGCTCTAGTTT pLKO.1 1665 3UTR 100% 5.625 3.938 N Fam118b n/a
7 TRCN0000130258 CCTTGACCTTACTGATGAGAA pLKO.1 677 CDS 100% 4.950 3.465 N FAM118B n/a
8 TRCN0000148692 CGAGAACTTGTGCTAGTGATT pLKO.1 255 5UTR 100% 4.950 3.465 N FAM118B n/a
9 TRCN0000147936 GTGAAATAAGAGGCTGTAGTA pLKO.1 1211 CDS 100% 4.950 3.465 N FAM118B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542978.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04088 pDONR223 100% 49.3% 45.6% None 0_1ins511;55_100del n/a
2 ccsbBroad304_04088 pLX_304 0% 49.3% 45.6% V5 0_1ins511;55_100del n/a
3 TRCN0000471505 GCTAAGCCCAAGAACTTAACACGT pLX_317 47.9% 49.3% 45.6% V5 0_1ins511;55_100del n/a
Download CSV