Transcript: Human XM_011542980.1

PREDICTED: Homo sapiens NLR family member X1 (NLRX1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NLRX1 (79671)
Length:
3650
CDS:
146..3073

Additional Resources:

NCBI RefSeq record:
XM_011542980.1
NBCI Gene record:
NLRX1 (79671)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542980.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149704 GAGGACTACTACAACGATGAT pLKO.1 1901 CDS 100% 4.950 6.930 N NLRX1 n/a
2 TRCN0000218246 AGACCCTTACAAGCATCTATA pLKO_005 1320 CDS 100% 13.200 10.560 N NLRX1 n/a
3 TRCN0000229816 GCATGACCAGTGCCAAATTAC pLKO_005 2470 CDS 100% 13.200 10.560 N NLRX1 n/a
4 TRCN0000149387 GTCAGAATACTGGTCAGTGAT pLKO.1 2863 CDS 100% 4.950 3.960 N NLRX1 n/a
5 TRCN0000229815 CGTCAACCTGCTGCGCAAATA pLKO_005 961 CDS 100% 13.200 9.240 N NLRX1 n/a
6 TRCN0000128446 GTCTGGAATCTCCAAGTTAAA pLKO.1 3243 3UTR 100% 13.200 9.240 N NLRX1 n/a
7 TRCN0000229817 GTCTGGAATCTCCAAGTTAAA pLKO_005 3243 3UTR 100% 13.200 9.240 N NLRX1 n/a
8 TRCN0000130325 GAGTCTGGAATCTCCAAGTTA pLKO.1 3241 3UTR 100% 5.625 3.938 N NLRX1 n/a
9 TRCN0000129459 GAGGAGGACTACTACAACGAT pLKO.1 1898 CDS 100% 3.000 2.100 N NLRX1 n/a
10 TRCN0000130268 CTCACATCTTATGTCTGCCAT pLKO.1 3429 3UTR 100% 2.640 1.848 N NLRX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542980.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12589 pDONR223 100% 69.1% 66.3% None (many diffs) n/a
2 ccsbBroad304_12589 pLX_304 0% 69.1% 66.3% V5 (many diffs) n/a
3 TRCN0000471148 CCCAAAGTTCAACGAAATGAAATA pLX_317 16.7% 69.1% 66.3% V5 (many diffs) n/a
Download CSV