Transcript: Human XM_011543013.2

PREDICTED: Homo sapiens cullin 5 (CUL5), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CUL5 (8065)
Length:
1996
CDS:
617..1807

Additional Resources:

NCBI RefSeq record:
XM_011543013.2
NBCI Gene record:
CUL5 (8065)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011543013.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293507 ACACAAGCACCCTCGTATTTA pLKO_005 1262 CDS 100% 15.000 21.000 N CUL5 n/a
2 TRCN0000011030 GCCATCAAGATGATACGGCTT pLKO.1 861 CDS 100% 2.160 3.024 N CUL5 n/a
3 TRCN0000293434 AGCAGTTACTTACACTATTTA pLKO_005 1641 CDS 100% 15.000 10.500 N CUL5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011543013.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07198 pDONR223 100% 49.7% 47.2% None (many diffs) n/a
2 ccsbBroad304_07198 pLX_304 0% 49.7% 47.2% V5 (many diffs) n/a
3 TRCN0000478636 CATACGCCTTTGGTCTGACAGTTC pLX_317 15.1% 49.7% 47.2% V5 (many diffs) n/a
Download CSV