Transcript: Human XM_011543250.3

PREDICTED: Homo sapiens ephrin A5 (EFNA5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EFNA5 (1946)
Length:
5147
CDS:
149..781

Additional Resources:

NCBI RefSeq record:
XM_011543250.3
NBCI Gene record:
EFNA5 (1946)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011543250.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438182 CCAGCAGATGACACCGTACAT pLKO_005 653 CDS 100% 4.950 6.930 N EFNA5 n/a
2 TRCN0000430141 CTATAGGTGTTCATGATCGTG pLKO_005 594 CDS 100% 2.640 3.696 N EFNA5 n/a
3 TRCN0000058220 CGCGGCACAAACACCAAGGAT pLKO.1 703 CDS 100% 1.000 1.400 N EFNA5 n/a
4 TRCN0000058219 GTCCTCTACATGGTGAACTTT pLKO.1 326 CDS 100% 5.625 4.500 N EFNA5 n/a
5 TRCN0000058222 CAATCCCAGATAATGGAAGAA pLKO.1 519 CDS 100% 4.950 3.960 N EFNA5 n/a
6 TRCN0000414980 TCCTAAGAAGGGACTTGTTAT pLKO_005 855 3UTR 100% 13.200 9.240 N EFNA5 n/a
7 TRCN0000058221 CCACACTTCCAAAGGGTTCAA pLKO.1 367 CDS 100% 4.950 3.465 N EFNA5 n/a
8 TRCN0000058218 GAGACCAACAAATAGCTGTAT pLKO.1 568 CDS 100% 4.950 3.465 N EFNA5 n/a
9 TRCN0000435962 GGGTGACTACCATATTGATGT pLKO_005 229 CDS 100% 4.950 3.465 N EFNA5 n/a
10 TRCN0000419093 GTCCTGTCTAAAGCTCAAAGT pLKO_005 541 CDS 100% 4.950 3.465 N EFNA5 n/a
11 TRCN0000421658 TTTCGATGTTAACGACAAAGT pLKO_005 616 CDS 100% 4.950 3.465 N EFNA5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011543250.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00484 pDONR223 100% 87.7% 82.6% None (many diffs) n/a
2 ccsbBroad304_00484 pLX_304 0% 87.7% 82.6% V5 (many diffs) n/a
3 TRCN0000481306 CTCCTAATAGGAACTCCTTGTGGC pLX_317 64.7% 87.7% 82.6% V5 (many diffs) n/a
Download CSV