Transcript: Human XM_011543267.2

PREDICTED: Homo sapiens FER tyrosine kinase (FER), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FER (2241)
Length:
13901
CDS:
2122..4635

Additional Resources:

NCBI RefSeq record:
XM_011543267.2
NBCI Gene record:
FER (2241)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011543267.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195272 CAGAACAACTTAGTAGGATAA pLKO.1 2354 CDS 100% 10.800 15.120 N FER n/a
2 TRCN0000002348 GCCAAGGAACGATACGACAAA pLKO.1 2620 CDS 100% 4.950 6.930 N FER n/a
3 TRCN0000002351 CAGTATGTATTGGCGTTGAAA pLKO.1 2671 CDS 100% 5.625 4.500 N FER n/a
4 TRCN0000002349 CCACCTCCAGTAGTAAATTAT pLKO.1 3307 CDS 100% 15.000 10.500 N FER n/a
5 TRCN0000194824 CAAACATTCCTCAACTTATAG pLKO.1 3686 CDS 100% 13.200 9.240 N FER n/a
6 TRCN0000002347 CGGCTGCTAAAGAACAAGAAA pLKO.1 2930 CDS 100% 5.625 3.938 N FER n/a
7 TRCN0000002350 GAGAGCAAGTAGAAAGAGGAT pLKO.1 4475 CDS 100% 2.640 1.848 N FER n/a
8 TRCN0000197121 GCACTGTCCAGAGGATATTTC pLKO.1 4515 CDS 100% 13.200 7.920 N FER n/a
9 TRCN0000196348 GCAGAAAGTTTGCAAGTAATG pLKO.1 3025 CDS 100% 10.800 6.480 N FER n/a
10 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 5425 3UTR 100% 4.950 2.475 Y ORAI2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011543267.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14636 pDONR223 0% 98.2% 98.2% None 2048_2092del n/a
2 ccsbBroad304_14636 pLX_304 0% 98.2% 98.2% V5 2048_2092del n/a
3 TRCN0000481126 AGGCTGTACATTGACAACTCCGAA pLX_317 17% 98% 98% V5 (many diffs) n/a
4 TRCN0000489132 AGAAAATTTGATATAATTGCCAAT pLX_317 13.3% 98.1% 98% V5 2048_2092del;2511_2512insG n/a
Download CSV