Transcript: Human XM_011543330.2

PREDICTED: Homo sapiens KIAA0825 (KIAA0825), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIAA0825 (285600)
Length:
12530
CDS:
258..4109

Additional Resources:

NCBI RefSeq record:
XM_011543330.2
NBCI Gene record:
KIAA0825 (285600)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011543330.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142249 GTGGAACTGCTTTCCTTCTTA pLKO.1 929 CDS 100% 5.625 3.938 N KIAA0825 n/a
2 TRCN0000145616 CAAACAACAACTGACTGCTTT pLKO.1 453 CDS 100% 4.950 3.465 N KIAA0825 n/a
3 TRCN0000141475 CAACCCTAAGTGGAACATCTT pLKO.1 649 CDS 100% 4.950 3.465 N KIAA0825 n/a
4 TRCN0000144489 CATTTCTCATGGAGACTTGAT pLKO.1 518 CDS 100% 4.950 3.465 N KIAA0825 n/a
5 TRCN0000144990 GAAACTTACCTGGATACTGTT pLKO.1 1086 CDS 100% 4.950 3.465 N KIAA0825 n/a
6 TRCN0000142489 GTCAAGTCTATGTGGGATGAT pLKO.1 726 CDS 100% 4.950 3.465 N KIAA0825 n/a
7 TRCN0000144762 GTGCTTACAACAACTCTTGTT pLKO.1 839 CDS 100% 4.950 3.465 N KIAA0825 n/a
8 TRCN0000144838 GTGAGCAAATTACAAAGCCAT pLKO.1 774 CDS 100% 2.640 1.848 N KIAA0825 n/a
9 TRCN0000141728 GTTGGCTAATCTTCTGTGGAA pLKO.1 914 CDS 100% 2.640 1.848 N KIAA0825 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011543330.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05402 pDONR223 100% 25.2% 25.1% None 971T>G;973_3849del n/a
2 ccsbBroad304_05402 pLX_304 0% 25.2% 25.1% V5 971T>G;973_3849del n/a
3 TRCN0000471785 AGCACCTACCCTTCCGCCGAAGAT pLX_317 50.6% 25.2% 25.1% V5 971T>G;973_3849del n/a
Download CSV