Transcript: Human XM_011543507.2

PREDICTED: Homo sapiens WD repeat domain 41 (WDR41), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WDR41 (55255)
Length:
1403
CDS:
288..1301

Additional Resources:

NCBI RefSeq record:
XM_011543507.2
NBCI Gene record:
WDR41 (55255)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011543507.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000369219 CTTGATCACCAGGATAATATT pLKO_005 942 CDS 100% 15.000 21.000 N WDR41 n/a
2 TRCN0000369220 ATACGTGTATAGCCTTCAAAT pLKO_005 1199 CDS 100% 13.200 18.480 N WDR41 n/a
3 TRCN0000149821 CCACCTTTCTGATACAGGTAT pLKO.1 794 CDS 100% 4.950 6.930 N WDR41 n/a
4 TRCN0000364522 CATGTTCACTGGAGCTTATTG pLKO_005 1373 3UTR 100% 13.200 9.240 N WDR41 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011543507.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15893 pDONR223 0% 99.5% 99.1% None 985G>A;1007T>G;1009_1011delTTT n/a
2 ccsbBroad304_15893 pLX_304 0% 99.5% 99.1% V5 985G>A;1007T>G;1009_1011delTTT n/a
3 ccsbBroadEn_03564 pDONR223 100% 73.1% 72.9% None 1006_1008delTTTinsCAG;1011_1011delTins367 n/a
4 ccsbBroad304_03564 pLX_304 0% 73.1% 72.9% V5 1006_1008delTTTinsCAG;1011_1011delTins367 n/a
5 TRCN0000491687 AATACCTCGCAAGCCACCGTGAGT pLX_317 25.6% 73.1% 72.9% V5 1006_1008delTTTinsCAG;1011_1011delTins367 n/a
Download CSV