Transcript: Human XM_011544132.2

PREDICTED: Homo sapiens fumarate hydratase (FH), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FH (2271)
Length:
2245
CDS:
732..2036

Additional Resources:

NCBI RefSeq record:
XM_011544132.2
NBCI Gene record:
FH (2271)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544132.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052465 CCCAACGATCATGTTAATAAA pLKO.1 1032 CDS 100% 15.000 21.000 N FH n/a
2 TRCN0000310398 CCCAACGATCATGTTAATAAA pLKO_005 1032 CDS 100% 15.000 21.000 N FH n/a
3 TRCN0000052463 CGCTGAAGTAAACCAGGATTA pLKO.1 812 CDS 100% 10.800 15.120 N FH n/a
4 TRCN0000299141 CGCTGAAGTAAACCAGGATTA pLKO_005 812 CDS 100% 10.800 15.120 N FH n/a
5 TRCN0000052464 CCGGATAGAATATGATACCTT pLKO.1 653 5UTR 100% 3.000 4.200 N FH n/a
6 TRCN0000299192 CCGGATAGAATATGATACCTT pLKO_005 653 5UTR 100% 3.000 4.200 N FH n/a
7 TRCN0000246829 ATGAGGTAGCTGAAGGTAAAT pLKO_005 877 CDS 100% 13.200 9.240 N Fh1 n/a
8 TRCN0000052466 GTGGTTATGTTCAACAAGTAA pLKO.1 1249 CDS 100% 5.625 3.938 N FH n/a
9 TRCN0000299140 GTGGTTATGTTCAACAAGTAA pLKO_005 1249 CDS 100% 5.625 3.938 N FH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544132.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00565 pDONR223 100% 85% 85% None 0_1ins228 n/a
2 ccsbBroad304_00565 pLX_304 44.1% 85% 85% V5 0_1ins228 n/a
3 TRCN0000481586 GCAATAAAGTAGTTAGTCGAGATG pLX_317 34.7% 85% 85% V5 0_1ins228 n/a
Download CSV