Transcript: Human XM_011544133.2

PREDICTED: Homo sapiens RNA binding motif protein 34 (RBM34), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RBM34 (23029)
Length:
1366
CDS:
55..1287

Additional Resources:

NCBI RefSeq record:
XM_011544133.2
NBCI Gene record:
RBM34 (23029)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544133.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336819 CAGGTCGCCAGTAGCTTATTT pLKO_005 163 CDS 100% 15.000 21.000 N RBM34 n/a
2 TRCN0000147405 GTGCTCTTTGAGAATACAGAT pLKO.1 991 CDS 100% 4.950 6.930 N RBM34 n/a
3 TRCN0000336816 GTGCTCTTTGAGAATACAGAT pLKO_005 991 CDS 100% 4.950 6.930 N RBM34 n/a
4 TRCN0000150268 GTATTAGAGTTGATCTCGCAT pLKO.1 809 CDS 100% 2.640 3.696 N RBM34 n/a
5 TRCN0000412959 GTCATGCGTTCTGTTAATAAA pLKO_005 1069 CDS 100% 15.000 10.500 N Rbm34 n/a
6 TRCN0000147509 GCTATGTGCTCTTTGAGAATA pLKO.1 986 CDS 100% 13.200 9.240 N RBM34 n/a
7 TRCN0000336818 TGCAGATGGATTTCGTATTAG pLKO_005 795 CDS 100% 13.200 9.240 N RBM34 n/a
8 TRCN0000147133 CACGATTGAAGAATGTCAGTA pLKO.1 1118 CDS 100% 4.950 3.465 N RBM34 n/a
9 TRCN0000336817 CACGATTGAAGAATGTCAGTA pLKO_005 1118 CDS 100% 4.950 3.465 N RBM34 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544133.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11660 pDONR223 100% 94.1% 94.1% None 1_15del;596_597ins60 n/a
2 ccsbBroad304_11660 pLX_304 0% 94.1% 94.1% V5 1_15del;596_597ins60 n/a
3 TRCN0000479571 GGACAGTTGTGGCATGATTTTGTA pLX_317 24% 94.1% 94.1% V5 1_15del;596_597ins60 n/a
Download CSV