Transcript: Human XM_011544260.1

PREDICTED: Homo sapiens SET and MYND domain containing 3 (SMYD3), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SMYD3 (64754)
Length:
1137
CDS:
197..916

Additional Resources:

NCBI RefSeq record:
XM_011544260.1
NBCI Gene record:
SMYD3 (64754)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544260.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000308170 GAAGTTGGTGTTGGCCTATAT pLKO_005 203 CDS 100% 13.200 10.560 N SMYD3 n/a
2 TRCN0000123290 GCTTCCCGATATCAACATCTA pLKO.1 586 CDS 100% 4.950 3.960 N SMYD3 n/a
3 TRCN0000289580 GCTTCCCGATATCAACATCTA pLKO_005 586 CDS 100% 4.950 3.960 N SMYD3 n/a
4 TRCN0000308169 GAACGCAGTCAGAGGGAAATA pLKO_005 919 3UTR 100% 13.200 9.240 N SMYD3 n/a
5 TRCN0000123292 AGCCTGATTGAAGATTTGATT pLKO.1 854 CDS 100% 5.625 3.938 N SMYD3 n/a
6 TRCN0000123293 CAGCCTGATTGAAGATTTGAT pLKO.1 853 CDS 100% 5.625 3.938 N SMYD3 n/a
7 TRCN0000289526 CAGCCTGATTGAAGATTTGAT pLKO_005 853 CDS 100% 5.625 3.938 N SMYD3 n/a
8 TRCN0000123291 CAACTCTTTCACCATCTGTAA pLKO.1 169 5UTR 100% 4.950 3.465 N SMYD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544260.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12481 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_12481 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479013 CTTTCTAGTAATTGAAGCAAACCG pLX_317 48.9% 100% 100% V5 n/a
4 ccsbBroadEn_08862 pDONR223 100% 55.7% 55.8% None 0_1ins567;366A>G n/a
5 ccsbBroad304_08862 pLX_304 0% 55.7% 55.8% V5 0_1ins567;366A>G n/a
6 TRCN0000473342 TGCATATGGCCGTAGACGGCTAGT pLX_317 38.4% 55.7% 55.8% V5 0_1ins567;366A>G n/a
Download CSV