Transcript: Human XM_011544271.2

PREDICTED: Homo sapiens Wnt family member 9A (WNT9A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WNT9A (7483)
Length:
4529
CDS:
782..1669

Additional Resources:

NCBI RefSeq record:
XM_011544271.2
NBCI Gene record:
WNT9A (7483)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544271.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062077 CTGCGGAGACAACCTTAAGTA pLKO.1 1072 CDS 100% 5.625 7.875 N WNT9A n/a
2 TRCN0000426431 TTCCGCTTTGAGCGCTGGAAC pLKO_005 860 CDS 100% 1.350 1.080 N WNT9A n/a
3 TRCN0000062074 CAAGTATGAGACGGCACTCAA pLKO.1 1306 CDS 100% 4.950 3.465 N WNT9A n/a
4 TRCN0000062073 GCAGCAAGTTCGTCAAGGAAT pLKO.1 1095 CDS 100% 4.950 3.465 N WNT9A n/a
5 TRCN0000437617 GTGGGTGTGAAGGTGATCAAG pLKO_005 1175 CDS 100% 4.950 3.465 N WNT9A n/a
6 TRCN0000062075 TGAGAAGAACTGCGAGAGCAT pLKO.1 1516 CDS 100% 2.640 1.848 N WNT9A n/a
7 TRCN0000436084 GCAGACGGTCAAGCAAGGATC pLKO_005 1122 CDS 100% 1.350 0.945 N WNT9A n/a
8 TRCN0000062076 CCTGGATGACTCGCCTAGCTT pLKO.1 1444 CDS 100% 1.000 0.700 N WNT9A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544271.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07136 pDONR223 100% 80.8% 80.8% None 0_1ins210 n/a
2 ccsbBroad304_07136 pLX_304 0% 80.8% 80.8% V5 0_1ins210 n/a
3 TRCN0000481446 CGCACGCACCATTTCGTCACGGCG pLX_317 37.1% 80.8% 80.8% V5 0_1ins210 n/a
Download CSV