Transcript: Human XM_011544289.2

PREDICTED: Homo sapiens SprT-like N-terminal domain (SPRTN), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPRTN (83932)
Length:
2906
CDS:
159..1244

Additional Resources:

NCBI RefSeq record:
XM_011544289.2
NBCI Gene record:
SPRTN (83932)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544289.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435272 GTTCTGGAGTCTCAGATTAAT pLKO_005 1161 CDS 100% 15.000 21.000 N SPRTN n/a
2 TRCN0000073312 GATCACTTCACATGCCATTAA pLKO.1 590 CDS 100% 13.200 18.480 N SPRTN n/a
3 TRCN0000073309 GCCGCAGAGAATAAAGATAAA pLKO.1 477 CDS 100% 13.200 18.480 N SPRTN n/a
4 TRCN0000073310 CTATGTCAAACGAGCTACTAA pLKO.1 317 CDS 100% 5.625 7.875 N SPRTN n/a
5 TRCN0000434833 TACTTTCCTAGAGTATCATTT pLKO_005 765 CDS 100% 13.200 10.560 N SPRTN n/a
6 TRCN0000414781 CATTCCCTGAACTGATGTAAA pLKO_005 1636 3UTR 100% 13.200 9.240 N SPRTN n/a
7 TRCN0000073308 GCTACATTCACTCTTGCCTTA pLKO.1 1432 3UTR 100% 4.050 2.835 N SPRTN n/a
8 TRCN0000073311 GTACAACCACAGCTCAGAATT pLKO.1 1084 CDS 100% 0.000 0.000 N SPRTN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544289.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09134 pDONR223 100% 69.6% 70.1% None (many diffs) n/a
2 ccsbBroad304_09134 pLX_304 0% 69.6% 70.1% V5 (many diffs) n/a
3 TRCN0000467163 TCTCTTAGGATATTAATGTATTTT pLX_317 27.1% 69.6% 70.1% V5 (many diffs) n/a
4 ccsbBroadEn_12763 pDONR223 99% 20.2% 19.6% None (many diffs) n/a
5 ccsbBroad304_12763 pLX_304 0% 20.2% 19.6% V5 (many diffs) n/a
6 TRCN0000468689 AACGATGAAAGACCCATGACACAG pLX_317 55.4% 20.2% 19.6% V5 (many diffs) n/a
Download CSV