Transcript: Human XM_011544481.2

PREDICTED: Homo sapiens adhesion G protein-coupled receptor A2 (ADGRA2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADGRA2 (25960)
Length:
6094
CDS:
387..4472

Additional Resources:

NCBI RefSeq record:
XM_011544481.2
NBCI Gene record:
ADGRA2 (25960)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544481.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000011554 CCGACTAAACATATCTGGAAA pLKO.1 863 CDS 100% 4.950 6.930 N ADGRA2 n/a
2 TRCN0000357191 ATCCCAGAAACACGCATAATA pLKO_005 4654 3UTR 100% 15.000 10.500 N ADGRA2 n/a
3 TRCN0000357116 GCTCATCACCTGGATCTATTT pLKO_005 3263 CDS 100% 13.200 9.240 N ADGRA2 n/a
4 TRCN0000357117 GTTATGTCGACCAGATCAAAG pLKO_005 1810 CDS 100% 10.800 7.560 N ADGRA2 n/a
5 TRCN0000011555 CCTGCTCTTGAGCAATAACAA pLKO.1 650 CDS 100% 5.625 3.938 N ADGRA2 n/a
6 TRCN0000011553 GCACAGACATATTAGAAGAAA pLKO.1 5842 3UTR 100% 5.625 3.938 N ADGRA2 n/a
7 TRCN0000011556 GCTGAACTTGTGCTTCCACAT pLKO.1 2810 CDS 100% 4.050 2.835 N ADGRA2 n/a
8 TRCN0000357115 AGAGCGAAACTACCGTCTAAG pLKO_005 4453 CDS 100% 10.800 6.480 N ADGRA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544481.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492170 GAGTTACTAGGCCCCGACTTGTTA pLX_317 12.3% 82.3% 82.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV