Transcript: Human XM_011544693.2

PREDICTED: Homo sapiens myotubularin related protein 7 (MTMR7), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MTMR7 (9108)
Length:
3951
CDS:
852..2123

Additional Resources:

NCBI RefSeq record:
XM_011544693.2
NBCI Gene record:
MTMR7 (9108)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544693.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146728 CCTTTGGAGTTCCAAAGTAAA pLKO.1 2130 3UTR 100% 1.320 1.056 N MTMR7 n/a
2 TRCN0000149319 GCTGAGCAGTTCCCAAATTAA pLKO.1 3684 3UTR 100% 15.000 10.500 N MTMR7 n/a
3 TRCN0000363351 TGAAGGGCTTCATGGTATTAA pLKO_005 1228 CDS 100% 15.000 10.500 N MTMR7 n/a
4 TRCN0000148562 CCAGGATTACAGTGGGAATAT pLKO.1 1877 CDS 100% 13.200 9.240 N MTMR7 n/a
5 TRCN0000149466 GATTCTGATGAAGCCGTGTTT pLKO.1 2091 CDS 100% 4.950 3.465 N MTMR7 n/a
6 TRCN0000146752 CCAGTTAAATTGCACTAAGGT pLKO.1 1784 CDS 100% 3.000 2.100 N MTMR7 n/a
7 TRCN0000030033 GCTATGAGAATGAAGACAATT pLKO.1 907 CDS 100% 13.200 7.920 N Mtmr7 n/a
8 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 14 5UTR 100% 10.800 5.400 Y MRPS16 n/a
9 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 14 5UTR 100% 10.800 5.400 Y CD3EAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544693.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07361 pDONR223 100% 63.8% 63.1% None (many diffs) n/a
2 ccsbBroad304_07361 pLX_304 0% 63.8% 63.1% V5 (many diffs) n/a
3 TRCN0000465949 GCTCGAGCGTCCCAGCTTCGCACC pLX_317 14% 63.8% 63.1% V5 (many diffs) n/a
4 ccsbBroadEn_14929 pDONR223 92.3% 63.8% 63.1% None (many diffs) n/a
5 ccsbBroad304_14929 pLX_304 0% 63.8% 63.1% V5 (many diffs) n/a
6 ccsbBroadEn_15656 pDONR223 0% 63.8% 63.1% None (many diffs) n/a
7 ccsbBroad304_15656 pLX_304 0% 63.8% 63.1% V5 (many diffs) n/a
8 TRCN0000465507 CTAAAGTGTTCGTGTCGTCAGGAT pLX_317 14% 63.8% 63.1% V5 (many diffs) n/a
Download CSV