Transcript: Human XM_011544848.3

PREDICTED: Homo sapiens leucine rich transmembrane and O-methyltransferase domain containing (LRTOMT), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRTOMT (220074)
Length:
1263
CDS:
589..1167

Additional Resources:

NCBI RefSeq record:
XM_011544848.3
NBCI Gene record:
LRTOMT (220074)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544848.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130029 GAGAAAGGGTATAGGCAATAT pLKO.1 1012 CDS 100% 13.200 18.480 N LRTOMT n/a
2 TRCN0000128686 CGTCATTCAAGATCTGGTAAA pLKO.1 660 CDS 100% 10.800 15.120 N LRTOMT n/a
3 TRCN0000130826 GAAGAGAAAGGGTATAGGCAA pLKO.1 1009 CDS 100% 2.640 3.696 N LRTOMT n/a
4 TRCN0000347011 CCATTGACCCTGTCCTAACAA pLKO_005 866 CDS 100% 5.625 4.500 N Lrrc51 n/a
5 TRCN0000148621 CCCTGTCCTAACAACTTTCTT pLKO.1 873 CDS 100% 5.625 4.500 N LRTOMT n/a
6 TRCN0000432190 ACAGCATGGTTTGACAATAAA pLKO_005 1208 3UTR 100% 15.000 10.500 N LRTOMT n/a
7 TRCN0000146854 CAATGATCTGAGAGACTTCAA pLKO.1 771 CDS 100% 4.950 3.465 N LRTOMT n/a
8 TRCN0000148354 CTCTTGACTACTCCTTCAGAA pLKO.1 632 CDS 100% 4.950 3.465 N LRTOMT n/a
9 TRCN0000131103 GCATGAACATCAAGCCCAAGA pLKO.1 1118 CDS 100% 4.050 2.835 N LRTOMT n/a
10 TRCN0000146985 CCTAACAACTTTCTTCAACCT pLKO.1 879 CDS 100% 2.640 1.848 N LRTOMT n/a
11 TRCN0000424730 GACCAAGCAGAATACACTTTG pLKO_005 1146 CDS 100% 10.800 6.480 N LRTOMT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544848.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05241 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05241 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475834 TGGGCCAAAGTAAAATCCATAGAT pLX_317 41% 100% 100% V5 n/a
Download CSV