Transcript: Human XM_011544939.3

PREDICTED: Homo sapiens cobalamin binding intrinsic factor (CBLIF), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CBLIF (2694)
Length:
1476
CDS:
49..1260

Additional Resources:

NCBI RefSeq record:
XM_011544939.3
NBCI Gene record:
CBLIF (2694)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544939.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045452 CGAGCACATCACAGCCAATTT pLKO.1 1227 CDS 100% 13.200 18.480 N CBLIF n/a
2 TRCN0000372474 CTACGGATATGATACTCAATG pLKO_005 794 CDS 100% 10.800 15.120 N CBLIF n/a
3 TRCN0000372475 TGGGTTCAGCTTCTATCAAAC pLKO_005 1269 3UTR 100% 10.800 15.120 N CBLIF n/a
4 TRCN0000045449 CCCTGTTTGGTCAGGTACTAA pLKO.1 638 CDS 100% 5.625 7.875 N CBLIF n/a
5 TRCN0000045448 CGTCTCTTCTATCAACAATAT pLKO.1 1113 CDS 100% 13.200 9.240 N CBLIF n/a
6 TRCN0000045450 CCAGCGACAACAACGATCTAA pLKO.1 290 CDS 100% 5.625 3.938 N CBLIF n/a
7 TRCN0000045451 GCATCTAACATCACTGTCATA pLKO.1 931 CDS 100% 4.950 3.465 N CBLIF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544939.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00637 pDONR223 100% 96.6% 96.6% None 828_829ins42 n/a
2 ccsbBroad304_00637 pLX_304 0% 96.6% 96.6% V5 828_829ins42 n/a
3 TRCN0000465838 ATGGTTCCGCCAAACGTGCTTTTC pLX_317 34.5% 96.6% 96.6% V5 828_829ins42 n/a
Download CSV