Transcript: Human XM_011545067.2

PREDICTED: Homo sapiens ovo like transcriptional repressor 1 (OVOL1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OVOL1 (5017)
Length:
2838
CDS:
343..960

Additional Resources:

NCBI RefSeq record:
XM_011545067.2
NBCI Gene record:
OVOL1 (5017)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545067.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229664 AGTGTCACAACGACGTCAAGA pLKO_005 569 CDS 100% 4.950 6.930 N OVOL1 n/a
2 TRCN0000015679 CCGCCACATGAAGTGTCACAA pLKO.1 558 CDS 100% 4.950 6.930 N OVOL1 n/a
3 TRCN0000229665 CTCAAGAGACACGTCCGAACT pLKO_005 637 CDS 100% 4.050 5.670 N OVOL1 n/a
4 TRCN0000218285 AGGATTTGATGGCTACCAAAT pLKO_005 2196 3UTR 100% 1.080 0.864 N OVOL1 n/a
5 TRCN0000257410 GCAGCAGAAGTACGCGTACAA pLKO_005 753 CDS 100% 4.950 3.465 N OVOL1 n/a
6 TRCN0000229666 CTCACCTCAAGAAGATCCATG pLKO_005 728 CDS 100% 4.050 2.835 N OVOL1 n/a
7 TRCN0000015678 GCTTCTATTTATCCTGGACAT pLKO.1 1752 3UTR 100% 4.050 2.835 N OVOL1 n/a
8 TRCN0000015682 ACCAAGATGAAGGTGACCCTT pLKO.1 463 CDS 100% 2.640 1.848 N OVOL1 n/a
9 TRCN0000015681 GCACTACAGAACACTGTCACT pLKO.1 910 CDS 100% 2.640 1.848 N OVOL1 n/a
10 TRCN0000015680 GCTTTGAACATGAGCCTTCGA pLKO.1 334 5UTR 100% 2.640 1.848 N OVOL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545067.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01130 pDONR223 100% 76.7% 76.7% None 0_1ins186 n/a
2 ccsbBroad304_01130 pLX_304 0% 76.7% 76.7% V5 0_1ins186 n/a
3 TRCN0000469203 CATCAGGACGTAAAATTGATAAGT pLX_317 57.6% 76.7% 76.7% V5 0_1ins186 n/a
Download CSV