Transcript: Human XM_011545157.3

PREDICTED: Homo sapiens CDC42 binding protein kinase gamma (CDC42BPG), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDC42BPG (55561)
Length:
5393
CDS:
118..4710

Additional Resources:

NCBI RefSeq record:
XM_011545157.3
NBCI Gene record:
CDC42BPG (55561)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147621 AGTGCAGAGTGGTCACCCAA pXPR_003 CGG 389 8% 4 1.3869 CDC42BPG CDC42BPG 77526
2 BRDN0001144777 CCGCAGCTCAGGAATATAGG pXPR_003 GGG 1054 23% 8 0.6997 CDC42BPG CDC42BPG 77528
3 BRDN0001162561 CGGCCCTCAGGTGTCCGGCG pXPR_003 GGG 2942 64% 26 -0.0685 CDC42BPG CDC42BPG 77527
4 BRDN0001162420 ACAGTGGGAGCAACGCCTTG pXPR_003 AGG 1735 38% 14 -0.3343 CDC42BPG CDC42BPG 77525
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545157.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358255 AGTAGGGACGCCGGACTATAT pLKO_005 810 CDS 100% 13.200 18.480 N CDC42BPG n/a
2 TRCN0000021472 CACGCATCTTTAGGGTGACAA pLKO.1 3245 CDS 100% 4.950 6.930 N CDC42BPG n/a
3 TRCN0000199864 GCTTGGAGTCTGCGCCTATGA pLKO.1 900 CDS 100% 1.650 2.310 N CDC42BPG n/a
4 TRCN0000199882 GCCCTCAAACTCCCTGATTCC pLKO.1 2538 CDS 100% 1.350 1.080 N CDC42BPG n/a
5 TRCN0000358254 TGTCCTGGCCTCTGATGTTAT pLKO_005 3201 CDS 100% 13.200 9.240 N CDC42BPG n/a
6 TRCN0000358253 CCATGGACACCTCCAACTTTG pLKO_005 1193 CDS 100% 10.800 7.560 N CDC42BPG n/a
7 TRCN0000368508 CCTTCGTATCAAAGGTGAAAG pLKO_005 284 CDS 100% 10.800 7.560 N CDC42BPG n/a
8 TRCN0000021471 CCCTTCGTATCAAAGGTGAAA pLKO.1 283 CDS 100% 4.950 3.465 N CDC42BPG n/a
9 TRCN0000199657 GCTGGGTGAATGATGAGAAGG pLKO.1 2174 CDS 100% 4.050 2.835 N CDC42BPG n/a
10 TRCN0000021473 GTACACACTCAAGGAGGCTTA pLKO.1 3405 CDS 100% 4.050 2.835 N CDC42BPG n/a
11 TRCN0000021469 GCCTTTCTAAGCCATTGGGAA pLKO.1 4947 3UTR 100% 2.640 1.848 N CDC42BPG n/a
12 TRCN0000021470 CCTACCAACTTCAACCACCTA pLKO.1 4391 CDS 100% 2.640 1.584 N CDC42BPG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545157.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15101 pDONR223 32.6% 95.9% 66.6% None (many diffs) n/a
2 ccsbBroad304_15101 pLX_304 0% 95.9% 66.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000473794 TAAGCAATTCAATCCATGGTATCC pLX_317 9.2% 95.9% 66.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV