Transcript: Human XM_011545292.1

PREDICTED: Homo sapiens calpain 1 (CAPN1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CAPN1 (823)
Length:
2973
CDS:
109..2253

Additional Resources:

NCBI RefSeq record:
XM_011545292.1
NBCI Gene record:
CAPN1 (823)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545292.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003560 CTAGAGACCATGTTCCGATTT pLKO.1 2152 CDS 100% 10.800 15.120 N CAPN1 n/a
2 TRCN0000003559 CGACATGGAGACTATTGGCTT pLKO.1 1416 CDS 100% 2.640 2.112 N CAPN1 n/a
3 TRCN0000432907 GCCTTGCCTGCAGACTATAAA pLKO_005 2614 3UTR 100% 15.000 10.500 N CAPN1 n/a
4 TRCN0000422363 CATTTCCAGCTGTGGCAATTT pLKO_005 556 CDS 100% 13.200 9.240 N CAPN1 n/a
5 TRCN0000003561 AGGGACTTGTGTACTGGTTAT pLKO.1 2860 3UTR 100% 10.800 7.560 N CAPN1 n/a
6 TRCN0000431534 GTGAAGGAGTTGCGGACAATC pLKO_005 1795 CDS 100% 10.800 7.560 N CAPN1 n/a
7 TRCN0000003558 AGAGGAGATTGACGAGAACTT pLKO.1 1728 CDS 100% 4.950 3.465 N CAPN1 n/a
8 TRCN0000003562 CCCAATTCCTCCAAGACCTAT pLKO.1 331 CDS 100% 4.950 3.465 N CAPN1 n/a
9 TRCN0000417952 AGGCCTATGCCAAGGTAAATG pLKO_005 686 CDS 100% 13.200 7.920 N CAPN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545292.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00214 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00214 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479881 GCCACTTTGTAGGCGCCATTCGAC pLX_317 19.1% 100% 100% V5 n/a
4 ccsbBroadEn_15373 pDONR223 0% 99.9% 99.8% None 1644G>T n/a
5 ccsbBroad304_15373 pLX_304 0% 99.9% 99.8% V5 1644G>T n/a
Download CSV