Transcript: Human XM_011545497.2

PREDICTED: Homo sapiens glycoprotein M6B (GPM6B), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GPM6B (2824)
Length:
3092
CDS:
204..1133

Additional Resources:

NCBI RefSeq record:
XM_011545497.2
NBCI Gene record:
GPM6B (2824)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545497.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430456 TCCGACAATACGGTATCATTC pLKO_005 832 CDS 100% 10.800 15.120 N GPM6B n/a
2 TRCN0000063816 CCGATGCATCAGTGGAATGTT pLKO.1 653 CDS 100% 5.625 7.875 N GPM6B n/a
3 TRCN0000091445 GTCTTCTAACTGGGCTTACTT pLKO.1 1004 CDS 100% 5.625 3.938 N Gpm6b n/a
4 TRCN0000063814 GCCCGTGTTTATGTTCTACAA pLKO.1 734 CDS 100% 4.950 3.465 N GPM6B n/a
5 TRCN0000063817 GTGATACAACTGATGCAGTAT pLKO.1 513 CDS 100% 4.950 3.465 N GPM6B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545497.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00668 pDONR223 100% 83.3% 81.4% None (many diffs) n/a
2 ccsbBroad304_00668 pLX_304 0% 83.3% 81.4% V5 (many diffs) n/a
3 TRCN0000470278 AGTCGACGGCATAAACCGTTCCGG pLX_317 37.1% 83.3% 81.4% V5 (many diffs) n/a
Download CSV